Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10A3.13   

sjj_F10A3.13 RNAi (5)
PCR_productsjj_F10A3.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10A3.13 Source_evidenceePCR877WS150 Sequence/Annotation Release
Overlaps_Gene F10A3.13 Source_evidenceePCR877WS150 Sequence/Annotation Release
Chunk_score Abs_score814
Max_abs_score814F10A3.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1616907416170269
Overlaps_transcriptF10A3.13 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10A3.131196cgtcacgaacacctctttcatattgttcacgcttcttgaacactctggattttcaaagccttcggggctgctatttttatgtaattaattttctttcaccttttttcgaatcggaaagtttcagcgttttccgatgcattctataggatgatcataactttgctagcaattcattttctataccgatacttatcggtggttcgtcccttcaatatgttcatattttccatgaaattcgcccctttgtggattctggttttggttttcaatttctctatgtggacattttgcttttactatttaaatggaccctctgaaatgaaagatgaagaagtgattcctgagtttttggatgtttactgtcttcacccaaatgagtacacctacacaggacctcactattattacacagacaattcaactggaaaatggaaatttcataatccctccttcgttgctgaaggctacacgggcggtaatgtagctttaaccataatttccgtagcatactttggctatcaaacctaccaacatctttataagcttggaacaatgacaagtgtgaactatcgggaggttcattatcagctattcaagacattactaattcaaacaatatttccaagtttacttgtgttcttcccggctgcctgtttaatattattccctgcttttggagtcggaatcggagaaaatgcaaatttattgatgatatcattttcaatgtacccatgtttcgaaccgcttgttgcagtgtgttgtattaaaagtttccggaaacgaatactaggtgggttcttcggtaaaaaccaacataaatggagtttttcaggcatttttcgatgtttgactgtcagaaagagctctcaaatttcaaatttatctacggtggtggttaccgggaaagtaacatgtgcataaatatttgattaaatgattttcctgacactaacaaagtaataaagtattgtgctctctctctctgaaataaatatttgtaaatataagttgaaatatttgcttttgaacatttattcacattattgcaaaatgagattatttgatttccaggaaagttggtcacatgcataagctataataattttacagggaaaaataataacaacgtctttaacgttattttcacaataaaggagtacaaaagttccaacctttgcaaccatctgccaattttt