Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10A3.15   

sjj_F10A3.15RNAiJA:F10A3.15
PCR_productsjj_F10A3.15
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10A3.15 Source_evidenceePCR960WS150 Sequence/Annotation Release
Overlaps_Gene F10A3.15 Source_evidenceePCR960WS150 Sequence/Annotation Release
Chunk_score Abs_score876
Max_abs_score876F10A3.15
Specificity_index0.912
Rel_score1
Map_statusUnique_ePCRV1617052816171719
K05D4.9 Chunk_score Abs_score85
Specificity_index0.088
Rel_score0.097
Overlaps_transcriptF10A3.15 Source_evidenceePCR960WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10A3.151192ggacgattcctgcaaatgtttagataattatcgaggtttatcagtgactataaaccaagcagtcgccgccggaaagttttaatgcaacaaatggcgacaagaggttcgaagcatggatatatagaaaatgaaatcatgatcagattagcattttctccaattctgattccgaaaactgggaacaaaactaagcatgacactgggaaaaataaaaatatacttgggaatatagtttggaccaccaaagttttgaacaattggctctgaatttcacgcgagttcagactagacattccaccaagtttataaagatggttgtaagttttaacgccaaatatgctcaatagaatgattgcaatagctatatttccagctgtatagccttcagccacaaacgacggaatatgaaatttccattctccagttgaattgtctgtgtaatagtagtgaggtccagtgtaggtatactcatttgatttaagacagtaagcctcccaaaactcaggaatcagctcttcatctttcattggagacggggagtttaaattaaaaaagcaaaagaaccaaatcacaaagttgacactgagagatataacccaaataggagcagctttcagagaaaatattgacaagttagatggagatttcacagatagataacgataaaagaaatgaattgccagcattgtcagcaccaatccatacgatgaacatagtattgcttgaattaaaacgattttgtttaaaaattttaaattataaattacctagagcaatttgcgcggtagaatatgaatatccagagcgtttcaagtctgtgaatatgatgaaagaagtcttggtgatgtgcatgttctgaatttaatttagagacaaatcccttattcgaaatttttctgttgaaggacatgtacaacaaacattcaaacttttattttcattaatttcagaaactccattttttgtacttgaaaaaaaaaacgtaccggtttgatgaaaaagtcacagcacgagaagaaaataccgactgttgaaaatgcaaacatcaggtacttatagttcccaaaaatcctcttcggcatttcactgatcaaaaccagtactatcaagttgaaagtgattgataatccaaatccaatgtttccagcataaaagtttgactccagccaaagggaggagcacatttctggaa