Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10B5.3   

sjj_F10B5.3 RNAi JA:F10B5.3
Simmer:F10B5.3
PCR_productsjj_F10B5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F10B5.3 Source_evidenceePCR739WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678F10B5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII81482878149474
Overlaps_transcript F10B5.3.1 Source_evidenceePCR739WS150 Sequence/Annotation Release
F10B5.3.2 Source_evidenceePCR739WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10B5.31188tctgtgctcttttcaatgcgcctggtgtgccaccacttgtcccatcggtttcgtgtcgagcaatatgtttttccaacattgcaggactttttgagacgtgtctacagaatggacactttcgagaacctggaatgaataagataaatggtaaaaattagaaactggagctcacctaaatcaatattttccggaagaggaatgtgatgacgataatatttatgaaaatgaatatatcttgcttcacgagttgaaaagttacatccattttcttcacatttaattggtggatttctatgataaatggtaacatgatatgaaactgaattgtaccgtccatagatctttcggcatacagtgcacataaatccgccatcaactttttcaatatatttcttatttcgacaccatccttctttatcatcatttggtacaatcttttcaagatcagttgttggtggagttgatgttgaattagcacgtggtgaacttccttctgattgtgttctactattctctgtatccgattgtggtgaaaatggcagacttggtgtaccagttgtatttccaaaaagtgcactgaagaatggattactccataaactgatcatactggacaaatagttttgaattggcggtgaggtgtactgtaggaaaggatttgaattcaaaggtacactttgtgagcaattcagtatattggctagatttaaaggcaatggagcaactgctgacatgatttttggctccagactcgatatttgacaatgacgagataccgcgagaacctgaaaataaaagtaaaatcgtaaatcgtcaaaaaatttaatttatagagaaaactccaatcaaaaaactccaatcaactttgattttcgaattaggcttaaaaattggtatattttttgacaggattttatttagaacctgaaattctaggatttcaaaagttgctaccttataaaaccatttcggatttttacagattttagagcatatctgttataccttcatagtgatttttatttattttcaagaattttctatcagagatttcatctaaatcaatttatttacgcacgaactcttgttcaaaaatcacgcggaactaaaagtgaaatgacgaatccccgtaatagtgatttctagaaacatcattcattactactcccgcctgtccaacttgaaaat