Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F10B5.7_f   

sjj_F10B5.7_fSequenceAAGATGCGCTTTTCCTGAGA
In_sequenceSUPERLINK_CB_II
PCR_productsmd_F10B5.7