Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10D11.4   

sjj_F10D11.4RNAiJA:F10D11.4
PCR_productsjj_F10D11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10D11.4 Source_evidenceePCR507WS150 Sequence/Annotation Release
Overlaps_Gene F10D11.4 Source_evidenceePCR507WS150 Sequence/Annotation Release
Chunk_score Abs_score444
Max_abs_score444F10D11.4
Specificity_index0.864
Rel_score1
Map_statusUnique_ePCRI84414258442363
T15H9.5 Chunk_score Abs_score70
Specificity_index0.136
Rel_score0.158
Overlaps_transcriptF10D11.4 Source_evidenceePCR507WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10D11.4939tgtcctactgcccaactttatgttcacgtggatattgataactattgtcttgtgttcctatcacgtctcccagagagcgtaataaattattattattattaattattattcataccaattaactttatttgcaaaggaaaatgtgaaaaagagtaatcagtaggcactttcagacttctaccttctccatacttccctcctttgattttttcttcttttgccgtcttgattctttcttcttggtttcaacttcatcgtcatgcgattccaagtccgtcttcggattttcctcttcttgctctttcttcgcaattttcagattctttataagaggttcattgttatccggtttgtcttccttcttcacttctttttccactttttcgtcaggtttcttgtcctaagaatcgaaataagaaacgtaaaacaattctaaactgttaccttctcctttttcttcgacctttccttcttcttactcaacaccttgatcagcgactttttcttcttatgcgaaatcggtttcttaatttcttccacagatttatcagcagacggcagttttttattcttcgagttggattcatcaatcgacatttgtgatggtgctgcaggttttggtggtgtttcctggacattttggacctgaaatgaaacaaatatttgaactccaaactctcctttaacctattgaaaacatgaagtcttcattttttttagagtgtgacgtcatgaaagttttgagagtgacatcacacagttattgatacgccacacttcaaaaaagaactcgctacgtttttcaaaactgttttataaaactaacctttgaagtctctgaaagcgagtctggtggtggtgggggcgaaggatcctttttattgttggcacagagcaacatgagaatcgatgtgaacagaaggattactgtagcggaaa