Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10G8.4   

sjj_F10G8.4RNAiJA:F10G8.4
PCR_productsjj_F10G8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10G8.4 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene F10G8.4 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699F10G8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1002429910025250
Overlaps_transcriptF10G8.4 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10G8.4952aaggaggcaaagagggtcatacgggagacacatacaacaataactattttataaattaattttttccaaatcaaaagcttacagatgactacaacctcgtgaatcttacctcaactcagagaaacccacttggatacatcaatgcatctgtggccgagtttcccgaaattggacgtcattatataattacgggcgccgcacaagacacacagattccatttttctggcaaatggtattcgaacagaaatctccggcaattgtgatgcttttggaagacgttgagttgggaattgaaaaatctgacaagtattttcctaacaatacacgagaagaacttaagtttggaatttatgacatcacatgcaaggagtttgtcaaaagaaacatacttgaatatagactactggaagttagtgttggaaatggttagtttgtattaaaaaatacgatatatatataggttgctatgaatatattttcatttcaaaaaccctcagaaacacaccaagttcaccattataaatttcacggttggactgaattcaatctaccaaaatatgaagactttatggcattctacaatacaatgaaaggttagttgaattacaaagatttcaattacgtagataatttaattatgttttccagaagttggagttccattacttgctgtaatgaaaaataactgtatgtcttcctttttcaaaaaatatcatcatactcctccaaccaatgctccaattattcaatgttcaaccggaggagctcgttgtggtgtattcataataattgatattcttatcaatttaatcgataatagaattaaaaattcatattcaattgagtggtggatgttaaaagtgcgaagtaaacgtaatcattctgcactcaccaaccaacaacattcatttatttatgatattattatcaaatacattcgaacgcgacaca