Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10G8.5   

sjj_F10G8.5RNAiJA:F10G8.5
PCR_productsjj_F10G8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10G8.5 Source_evidenceePCR573WS150 Sequence/Annotation Release
Overlaps_Gene F10G8.5 Source_evidenceePCR825WS150 Sequence/Annotation Release
Chunk_score Abs_score762
Max_abs_score762F10G8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1003379510034793
Overlaps_transcriptF10G8.5 Source_evidenceePCR825WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10G8.5999gctggtaagtagggagcaaaaattaatggcaacgaagtgtgtgtgtctgtggagaagaaataaactttccgggattatggggagacggctggaatgcttcgcgggagacagggagacgaggaggacgaacttcaggaaggaatcacagcggatcgtgagagaattaagagcaaataatattagacaaaacaattttagggcaaaaaacttgaaagaaagttcgtttacttcttgacttcattggtcaaaatttggaagagctccttatcagcaaggcagccgtcaacgaattccttcaatgtcagctctttatcattgttaacatccatcttctcgaagatcatcttggctctctttcttggagagtcgtcagcagattttgtcacttctgggccgagcatttcatagatggcctgaagaatttatttttaggatgacgattaaaagtgacacttgacacttttcaaagaagggaaataattccgttttcttttgtttctgattgaaaaaagctcacctcaataatcttgatcatttccttctcgtctatcgtaccatttccatcaatatcgtacatacggaaagcccattcaagtttctgctcgggcgttccggaactcgtcacattaattgccaataaaaattctttgaagtcgataaaacccgagttatccgtgtcgaatgttcggaatacatgttcacagaatccttctgcagaacctgacgggaagaaatccttatacacctttatgaactgctccttggttaagtggcctttcggacaatcttgctgaaaattgcaaaattttacagaatcatgtcagcttttatcgtttcaagccaaaaaacgaaaaacttaccacaaatcctttataccattctttgatctgctcttcggtgaaatttgtgttctttttcaaaaactccaaatcctctttggagagttttggcttggaacccttgattcccatggtttgggcttattcgtcttctaggtgt