Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11A10.2   

sjj_F11A10.2 RNAi Simmer:F11A10.2
PF:GL1_8B1
PCR_productsjj_F11A10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F11A10.2 Source_evidenceePCR87WS150 Sequence/Annotation Release
F11A10.7 Source_evidenceePCR835WS150 Sequence/Annotation Release
Overlaps_Gene F11A10.2 Source_evidenceePCR175WS150 Sequence/Annotation Release
Chunk_score Abs_score154
Specificity_index0.159
Rel_score0.189
Map_statusBottom50_percentile_ePCRIV1208511212086227
F11A10.7 Source_evidenceePCR835WS150 Sequence/Annotation Release
Chunk_score Abs_score814
Max_abs_score814F11A10.7
Specificity_index0.841
Rel_score1
Map_statusBest_ePCRIV1208511212086227
Overlaps_transcript F11A10.7 Source_evidenceePCR835WS150 Sequence/Annotation Release
F11A10.2 Source_evidenceePCR175WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11A10.21116tggacgatgtggaacaaagacacgaagcaattcttcttacaagtcgcattcaaattggaacgactcgatgatcagccgtactattgatactctatgtttttatctttttgatttcaaaattcaaaacaattttttcgtgtttttcgatgatctaacaataaattattttccttttttttaatgatgatattttatttaaatcaagtataggttgactgatccgtctacaatgtctattcaattaaaattatagttttcatagtttaaaaaatcagtttcagatggcgaagaaggttgtcaaaagaaaagctgaagcagtgtccgctgacgcagaagccgttgcagaagctccgaagaaaatcaagaagcagaaaccaagtcttccagtctctgaacctgataattatcaggctggtggattatcaagtctcttcggaaagtcgtcagaaggagcagcagtacaagaggaagttgtgaagggagataaagtaattgaaaaacctaaaagaagaaagtatgatccaaaaaaaaaggctgaagaagagaaggcagctgatgctgctgctgctgctgaagaagttgcacctgaaacagaaggagaagagaaaaaagatgaaaataaggaaggaaagcgagacagaacgaagcaaagagagaatagaactcttcaaaagtcaaatgcacgtgcttcagctgctgaaaatgctctgactgtttttgttggaaatatgccattgacaatgaacgagaaatcagtccgtcgaattttctccgactttggaactatttcctctgtccgtatgagaaatctgcttcctgcgaatgagaaattgacgaaacgagtcactcatttgacaggaaaattgaatgacaaacagagttctctcacgttctatgtgaaattcggagcagaagaatcagtggagaaagctctgaagtacaatggaaccaagctggacgatcatgtgattcgtgttgacaaagttggaagtaagaagaaagaatttggaaaggatatggccatttttgttggaaacttgccgttcgagattaccgaagatgctctcattacttttttctctgcacaaatcggacctgtcgaggctgtcagaattg