Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11A10.3   

sjj_F11A10.3 RNAi (7)
PCR_productsjj_F11A10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11A10.8 Source_evidenceePCR807WS150 Sequence/Annotation Release
Overlaps_Gene F11A10.8 Source_evidenceePCR864WS150 Sequence/Annotation Release
Chunk_score Abs_score801
Max_abs_score801F11A10.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1209248312093526
Overlaps_transcriptF11A10.8 Source_evidenceePCR864WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11A10.31044agctcctttgtggcatctgttggcgtagtgacctttctctccgcactaaaattgaattattttactttttttatgattaaaatgaacctaccttgtaacaagtaacatctgatagattctttttatctggtataagtgagagatcaacacgatggtgatgatcttgattttgtcttgtttgtcctggaagatgtggacatgtagttgccttgtggcctctttcatgacaattgtggcaagtaatagcttgactgtatgttggtttggcatgactgacagctatattctcgaatgatggcagaccgaatgaaggatgagcatattgacaatctggtccttgtagacaaaatccggcgagatagttggggcagactgcacgacgacgatggcgatgtttgcagtatggtccatgcctgcagaatccacgatcgtaccatggacagtctttcattttcgtttcgggatcaatatgtcggaatgggcattctcgattgctgcacgcgctgtatttagagaagaagaagcattcgggcatttttgtgaggtcatattcgtgcaagaattcacattgatctcctttcttacaaagaccacgaagccaatgcttacatacgacagctttttctccatcgatgtgacgaagagggcatgttggaccgaatggacacatttttaatttgtttttcctacaaaccgcttttccacttcgatccagatcgcgaaagggagcctgaaaattgaatatgtgttgtaattttatactggaagaataattgtacctctttcattcctctttgattgaacaaagcttcttccacatcagtcataggagcggtaatattcgaaacaagatctgtcatggtttgaggagcgaataatctttgcatcggatttagctgcatatccggaacatgctgcgccaccacaatcatctgagaataaaataataattgattgactaaaaaagtaatgattaatcaacttgtttctccggagaaacaaaaaaaaactccagaaataaaaatcagccaagcatcaaagttg