Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11E6.5   

sjj_F11E6.5 RNAi (6)
PCR_productsjj_F11E6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11E6.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
Overlaps_Gene F11E6.5 Source_evidenceePCR781WS150 Sequence/Annotation Release
Chunk_score Abs_score676
Max_abs_score676F11E6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1746627317467373
Overlaps_transcriptF11E6.5 Source_evidenceePCR781WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11E6.51101agaagaacttggcaaaaaggaacaaataactgatgtacatgagtcctccgatcgatagcacattccagctaaaattgtatatttcatcttcaaagattttgaaatgttttttttaaatagacaatggcatgtcagaaatgttgcgaatagttgtttttttgaaaattgaaaaacgagcttgtcgacgtacctaacagcgcaaccaggaacagaatcagcagacttaatgaataccaaatgcccaaaaatgtagcatgagatgacaaattggacaatttgaatagtagtgatgaactttgccactgggcgtggagtttggatgttcaaggcgcgaacggcgaagtagctataaaaaagatttgaatgtattagatacttttaactttataggtatttattgaactcacaaatacataacagtgtggacggcaaggttgagagccaaagaccaacgagcccatgcctgatgctcagagtatgtgactactgcgtagacaaatgtgagggcatgatgataccagtgcatgaagataactggttttttacgaaggaccaagaacatagtatcccctagttctggagctttcgacatcacaaaggcccagccccagaatccagttgatgcatcggtgtagtagttctcgttttgacagtaggaagctaaaaatggaatattttatataagcttgtaaagttcaagataatatcttaccgacaaacccgtccttcatgaaaactccgaatagttctggaataagcttataggcggcgattcccgagaacagtgaaaacccgaagttccagagagcaagtgtattttggagatcgaatggttttctgtgagccattaatttttgcccgaagtagatggtgacgagataaccaatcatgatctgaaaattgatacattttcaaactttgaatagttttgaatttgagatttgtagtgaaattaatcaaaatcttactttataggataatggtacaaatgtagacatgtaagaatcagtctgatccagactccatggttttgtcaaaacatcgacgagcgtggctgctggacttgtttgtgctgctgccattgtgattacctgcaaattt