Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F13D11.1   

sjj_F13D11.1 RNAi (5)
PCR_productsjj_F13D11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF13D11.1 Source_evidenceePCR727WS150 Sequence/Annotation Release
Overlaps_Gene F13D11.1 Source_evidenceePCR727WS150 Sequence/Annotation Release
Chunk_score Abs_score601
Max_abs_score601F13D11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX58294195830460
Overlaps_transcriptF13D11.1 Source_evidenceePCR727WS150 Sequence/Annotation Release
WB_DNA_textsjj_F13D11.11042cgcctcgtgcttttgttattcttcttgttcccggtggcttttggtaaattgaagtttgttcaaattgttagttttttttttcaattttttcaaaagtctataagatcaaaagtatcaatcctttcagtggttccgacatggagaaagaactccaggtcactatttgtactttcctggtgatgatttgaataatgtggactatcaacaaattgcatggcccggagagctaacaaaagttggtttttttttgttttcaagctagggcagtttttttaagaaaacattttcagcgcggaattttagaggaatttcaacttggtcaacgactgaggaaaatatatggggagcattttggagacacgtaccaaccgagagatgtaagtgatacaagtgaatatttaaaaagcgccaactttcaatttgaattttaaattttaaaattagtttgtttctctgaacatataaataactgctcagtttcacgtctacactgggaaagacaatcgaacttctgcatctgctcaagctatgtttgcaggattccttccccctaatgaagatcaaacctggaattacgagctcaaatggcaaccagtcgctcaactaactgatgaatccattgattgggtttgtttgttcttgtttattaacaaaagaaattgataattttatcaggtttcactaggagcaattgataactgtccggtctatggtgaagcacaacggaaatcatctgaatatgcagaagttatggatcaaatggaaaaatatgacgctgagcttttacaacttgtcagaaatcatgcagatgaaccaattgtggaagctgtgaaatataatcatgttatagactctttaaaagttcgggtaaaaagttaacattgtcgcaacttgatggaagagtttaaatttcagtacattcttcaagatgacagacttccgtacccagaatgggcgcgtgggtacgaaaatcgaattttgaatatgagttttttgattcacgatgcagttgttaaggttcaaaatgatagcgtcggaggtg