Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F13D12.6   

sjj_F13D12.6 RNAi (5)
PCR_productsjj_F13D12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F13D12.6 Source_evidenceePCR723WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681F13D12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1174052411741584
Overlaps_transcript F13D12.6.2 Source_evidenceePCR723WS150 Sequence/Annotation Release
F13D12.6.1 Source_evidenceePCR723WS150 Sequence/Annotation Release
WB_DNA_textsjj_F13D12.61061ccttcgcaccaatccatactcctggaacaagaatgcctcaattctcacccttgaagctccagccggagttggatactcttacgccacagacaacaatattgcaaccggagacgaccagacagccagtgagaattgggaagccctcgtcgctttcttcaatgagttcccacaatacaagggaaacgatttctatgtgactggagagtcgtacggtggaatctatgttccaacacttgttcagactattttggatcgtcaatcacaatctcatatcaatattaagggactcgcaatcggaaacggatgtgtttcagctaacgagggagttgactcacttgtcaacttcttgtaccatcacggagttgttgatcaggttggggcagttttgaatatttgaaaataggaagcctaagcctaattctaagcctgaacctaagcctcattttaagctcaaacctaaacatacgcctaaatctattttcaataaaaaaacacttccaggccaaatgggagcacatgaagacctcgtgctgccacaacgacactgatgcctgcccatggcactcgttcagcgagttctcggcctgcggagaattcgttgaagctacccaacagaccgcctggaacggaggtctcaacccatacaacatgtacgccgactgcatctccaccagcgcaagcttccgtttcggaatggagtatgagagaagattcaataagaagtacacaccagaggttcttggaaccgttccatgtcttgatgagagcccagtaaccaattatttgaaccgtcaggatgtgcgtaaggcactcggaattccatcttctcttccagcttggtcgatttgcaggtaagattctaaaattttgcattgtgtaaaaacctatatatctcaaaatctacaagtgttaaaaaaaggttgtcaactaacaaattaaagctcttaaagttttgcacattttgccgacaacttttttgtatgtccaatagcaaataagatataccttttccaaatattttactcaaaatcggtgggcgaatttgcctacatgctccacag