Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F13G3.9   

sjj_F13G3.9RNAiJA:F13G3.9
PCR_productsjj_F13G3.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF13G3.9 Source_evidenceePCR441WS150 Sequence/Annotation Release
Overlaps_Gene F13G3.9 Source_evidenceePCR485WS150 Sequence/Annotation Release
Chunk_score Abs_score422
Max_abs_score422F13G3.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73123887313559
Overlaps_transcriptF13G3.9 Source_evidenceePCR485WS150 Sequence/Annotation Release
WB_DNA_textsjj_F13G3.91172ctcgttgttgcgtaaccttaatcgccatttaacagttttgctcacgtattcttcaaagacgaacatacttttacattttggaaaaatttgtcgagaccacacaccagacaccgtatttttagcgccaaaatcacactaataatattacatttaaaatctcatttttccgaaattttgattcggaaattccaaaaatataatgaaattgggagaactttttcagatttatggtggcaacgaaatgagggttcaaacaagtttggagatcctagtattctgtccgagcctatttcgacagttggaccctgacaaaatttcgattagatcttcgatatttagaatctcctctcaatccgaacttctgagtagtgccgtttctcatgtttctcgcactaattgtaagattgttttgataaacttttattatgattttacaattatttacaaatgagttaccgtttgggttaaaatttttgaaaagtgaattgaattgagggaatgcaattatggaattgagtgttcagatatatttgaggaattgaaggaggaatgcaagaaacgcaatgcctagaactccaataatgaagcgagcacgatctgtagagatgaatggtcgattttcggtaagaatatgtccattgaatccgataagttccgggcttagcgatcgataattaatgaggactgcgtcagaatctagagccagctcctgcgagaagaattcacagagagcaaccgtgtattcttcggtgagaatcggagtaagaactgtggatgatgtgacatctaaaacagctaagggatcagtcaattgtcctcgcgtcattcgagaattcatgtcgagctgaaaaagttgatttaactgtcgtgaatacgatatcataaattgaaataattatagttacctattcagaaatgagtagttgttttttaacaatatagtagtgttcgggtaaaattataaaactactcaccgagacgaatatctggctttcaggacgtttcatcactttcgccatatgaattgcaagtcggacctgaaaaaattaggcttatttttgaagaaagatttaatcttacctcgaacccatcggatacttttttgacatttgtttgcactttgatgacgggcattctgcacacaaaaatggtgaaaactggggattttacat