Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F14B6.4   

sjj_F14B6.4RNAiJA:F14B6.4
PCR_productsjj_F14B6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF14B6.4 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene F14B6.4 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598F14B6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1223663412237807
Overlaps_transcriptF14B6.4 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_F14B6.41174tatttcaagcaaaaacccgcaaaaattctataaaaaatcatattccagtgctgaaatctatttcaggtctccttaattaccagattgataaaaatctacaaaaagaacacgaggaacacaaactagcactgaccaattgtatgaaaagtggacgaatattcagtaagtcacgagattctaaaattttcagcaaatacataagtttccagactcaagtgtccctgaaaccaaagactttggctccagcttcaccatatcttttgctgacatccagaaaacccacagctggctttacctacccaaatttcaaaactccatgagctcggagatccttatgatagtcgcttcaaggacggatagctttgccaggcggaatgttttgaggaagacttggatgaacccggagaacagtgaaataataaaagatggaaggatgaaagcccttttcctagttgggatgacagatggggatgactcgagaatgaggaaggttgtgatggaggaggcaaggatctatggggatatggttgtggtagatttgaaggatacatatgaggagttgccgtttaaggtgagttggcgtggcctattttttgaacatggtgcaacgataaacttgtaaatatttttcttaaatttgaattagaaactcatagaaaaatactttgaacatacaaaaatacaaaaataaataaactagtctagactagtcttttgtcatggtgcatcaatacgtttgacagtttaggctttatcaaaaagtttaagagtaagattgcaaaaaggaaatgctgctgatcgatgcaccatgttattctgtagtgcgagacccaaaaagtgtcggccgctgcgaaagcaggtttcaactttgaactttcagtctctaacaactctgctctacggaaccagcaaggcttcagagttcaagctcatcggtaaaatcgacgaggacattatgttcttccctgacaagattctaccattgctagaacaaaatttgatagacccaagctcggagagcatatatggaatgctttttgcagagggaggatatgtgtatcgtgataaagaacatagatggtaagtgttgtgtaggaagatcaataaatatgtacttctaaattcccaggtttgtacctgattcaacctatgggtgcgacatgtttcctccata