Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F14D12.2   

sjj_F14D12.2 RNAi (6)
PCR_productsjj_F14D12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF14D12.2 Source_evidenceePCR863WS150 Sequence/Annotation Release
Overlaps_Gene F14D12.2 Source_evidenceePCR863WS150 Sequence/Annotation Release
Chunk_score Abs_score716
Max_abs_score716F14D12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX55932375594405
Overlaps_transcriptF14D12.2 Source_evidenceePCR863WS150 Sequence/Annotation Release
WB_DNA_textsjj_F14D12.21169gcaagtatggcattcggagtgttttgtgtaagtttttataagttagaattaagagaactcaaaaattgcaaaaaaatttttagatgtgctcaatgctttgagccattcccagacggcatctactttgagtatgaaggacgaaagtactgcgagcatgacttccatgttctgttctcaccatgttgtggaaaatgcagtaagtatctttgagaagacacgcagagccataaatgttttatattctagacgagttcatcgttggacgagtgattaaagcaatgaatgccagctggcatccgggatgtttctgttgtgagatttgcaataaacagttggccgatgtcggatttttacggaacgctggacggtaagttggagagcgtaaacgaagctcgaaagaatttcaattttcagagctctctgtcgcgaatgtaacgaacgggaaaaggcagcaggtcatggacgatatgtgtgccacaaatgccacgcaatgattgatgatggacaacacatcaaattccgtggagattcattccatccttatcactttaagtgcaaacgttgcaagtaagaatttatcttgttttacagtatgagttgaatttaaaaaattttcagcaatgaattaacgacagcttctcgtgaagtaaacggagagctctactgtctcagatgccacgataccatgggtatcccaatttgtggagcatgtcacaggccgattgaagagcgtgtcatcgcggcactcggcaagcactggcacgtggagcactttgtctgttccgtctgtgagaagccattcttgggacatcgtcactacgagagaaagggacttccatattgcgaacagcacttccacaaggtacttgaaatatgaacaagcaaacattaataagtttgttgcagttattcggaaatctttgtttcaaatgcggagatccatgttgcggggaagtattccaagctcttcagaaaacgtggtgtgtcaaatgtttctcctgcagtttttgtgataagaaacttgatcagaagtgagtgcaaaactattcatatgaacttgatgaaaacaaattaatgtatgcattgcagaacgaaattctatgaattcgatatgaaaccaacatgcaaacgatgttacgatcggttccccacagaattgaaaaagcgca