Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F14D2.2   

sjj_F14D2.2 RNAi JA:F14D2.2
Simmer:F14D2.2:Repeat_a
Simmer:F14D2.2:Repeat_b
Simmer:F14D2.2:Screen
PCR_productsjj_F14D2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF14D2.2 Source_evidenceePCR537WS150 Sequence/Annotation Release
Overlaps_Gene F14D2.2 Source_evidenceePCR554WS150 Sequence/Annotation Release
Chunk_score Abs_score533
Max_abs_score533F14D2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII33589313359833
F14D2.4 Source_evidenceePCR35WS150 Sequence/Annotation Release
Overlaps_transcript F14D2.4a Source_evidenceePCR35WS150 Sequence/Annotation Release
F14D2.2 Source_evidenceePCR554WS150 Sequence/Annotation Release
WB_DNA_textsjj_F14D2.2903ttttactcacttcaaatgtgccatttaataaattctagtgcttcttaatttaatttttattgatttttatctcgttttatcgattttaatactcgaaaaatatacatattttagcaacgtcctttgaagatatcatctttctcttttttttcaaataattttttatgctcttttacatctacatgataaaattccaaaatttcagagcccatgtctcgcatcaagcaggaacaggtgaacccaccaccaccgccacgcgccatcactccacttcccccggcgacacaccggatcacgatggatgagtataagaagagggagaagaaagactattatcgagatgccaccaaggacgcgagtgtcaagaaggttgtgctctcgctgctcaaggactatcccgacatgtggcagaacggtaatcgatttcagactcggaagtggcgagcgctcggagttgaagtgtatcagaggactgggcagattgtcggtggtgagttagggttcgtctccggggaagtttcaagtcccgtgagatgtcgggatatactggagtgacgtcacacggctgtaccattgaaaagtcacaaattacgataaaatgtttcagtggacgacatgcgaaagatgtttatgtcgggaaaaaccgtgctcaaacagaaaatcaccttctgcatccggaatatgaagatggaccgcgccgctaccgaggccgacctccagaattgggagtactaccgtcactttctctactaccgtcagacgcttggcaagtttgaggcgaagcttcgcggtgagcagtggatcggagaagatcaagttgaagacgatgacgaagatgatgtcatattcgatggggagtcgtaaggtgatctgagcaatcggttagttagggtggatggtttc