Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F15D3.1   

sjj_F15D3.1 RNAi (5)
PCR_productsjj_F15D3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF15D3.1a Source_evidenceePCR955WS150 Sequence/Annotation Release
Overlaps_Gene F15D3.1 Source_evidenceePCR955WS150 Sequence/Annotation Release
Chunk_score Abs_score892
Max_abs_score892F15D3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1154332711544519
Overlaps_transcriptF15D3.1a Source_evidenceePCR955WS150 Sequence/Annotation Release
WB_DNA_textsjj_F15D3.11193agcaatgtccacgtcatcaagattacggtcggtgaagacgtcgagtaccaggaggaatgagtcaatatcctgaaaaattgcaaagttttttttaatgcggccattcaattatggctagtgagagtactgtagttttgttgaagataccaaaatagtgagtgtaagcctcagcctaagtctaagtctaagcctaagactaagcttaagcctaagcctaagcctcagactcccagaactcaccttcttcagctgctcatgctgctccacaagcgacggcaccttatcccgatgcttatccaactccacctccacctgctcaatccgattcgtcagctcatccagcttctcaatagccgaatgtgtctgaagctccagtcttccagtctctgcaattttccggccttcctcaatagtatcatcaagagctggtcggtactcatccaaatactcatccaaattctcaactcgcttctgatattcagtcaccattgatacgggagatccattgaaatccagctgagcttccaagttttcaaataggtcgcacagttcttgaactctcttgtcgaatggctgctcggacggggagcttaatctagcgtcacggagctctggagcaggagctttttcagcagaagcctttacttccaactccttccatttctgattcaatccagctagaacatcagatgacgtggcagctagccggggattcttggccgctagcttcctggttcgagaactcaatcgatctctgtcggctctcaagaatcgcagcttctccgcaattttcgatggttccttatcagaaactagcttaagctctttctcaaggttctggtggagctcgtcgatttccaacagggcagactcatcgtcctcggacatttcctgaatggtacggcaccacgagttcaggcggtttttgagagcatctgcacggagccgcttcagggagagcacgtcgtcagggatttttatggcgcgttcgctgaaattaagacatggcgcatggagtgaaatttgaaattttttaaaaaatcaataagaaaactaacttcaactgtctctgcaagtgctcggcattcttcatcgcagcctcattccgattccattcacttatgagctcattgacaatttcagcttcttccggccgatcacttgccgcgtattggtccaatttcccttccatt