Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F15D3.2   

sjj_F15D3.2RNAiJA:F15D3.2
PCR_productsjj_F15D3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF15D3.2 Source_evidenceePCR191WS150 Sequence/Annotation Release
Overlaps_Gene F15D3.2 Source_evidenceePCR191WS150 Sequence/Annotation Release
Chunk_score Abs_score150
Max_abs_score150F15D3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1156413611565089
Overlaps_transcriptF15D3.2 Source_evidenceePCR191WS150 Sequence/Annotation Release
WB_DNA_textsjj_F15D3.2954attttggacaattgaagcacactgttcaaagtaccaattatctggaatagtttaaaaattatatttaataccaactaagtaataactcacattataaagtcctccttgagtcactccttttgaatcatccaccactgcaacaacgtcaagccatagattgctcagatctcggccgcactcgcgttcggggatattcgccgagcaagatccgagtaggaagagaataagcagtgatttcatactgaagatggttttagggacacttggcagtgccttttatacagaatcatgtttgtatggtatgcggaaaatggtgttatgataagattatcagttgttccggtgcgagttgtttgaagtaatgtttgggcagaagtgatgcattactttttatttggttttgaaataatgaaaagtatagtttttttttacttttctatctcaaatcattagacaaaattgaaattcatatcggcaaacaggcaaatttccggaattgaaaatttccggcaaatcagctgattgccgaaaatcaaaatttccggcaaatcggcaaaccggaaaattgtaggaatttaaaattcccagcaaatcggcaaaccggcattctggagaaattaaaaattccggcaagctcaaagcgtctggagtcaccatcatcgcagtgacaatgcaggacgacgacgcaactctctacaagaagttgaaggctattgcatccccgaatgccatattcaccaattatgatgggatccttgtagcagagatccaggaaactttgctccaaactaactgcttccgccctccactttagtatcggcttagggttagtcttaggctgaagttttggcttagtcttaggctcaggcttaggcttaggcctaggattaggctcaggcttcgactgttaatttcactttcctttcaaaacgtgaagaccaagagggagaaaat