Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F15D3.4   

sjj_F15D3.4RNAiJA:F15D3.4
PCR_productsjj_F15D3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF15D3.4 Source_evidenceePCR972WS150 Sequence/Annotation Release
Overlaps_Gene F15D3.4 Source_evidenceePCR972WS150 Sequence/Annotation Release
Chunk_score Abs_score873
Max_abs_score873F15D3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1156824711569841
Overlaps_transcriptF15D3.4 Source_evidenceePCR972WS150 Sequence/Annotation Release
WB_DNA_textsjj_F15D3.41595attttgttggcaaatgtgagacttttttcaggcctggccttaaaatttgatattcttacagacacctatcccggccaacttgagaacaacaagatgatgaacgatgacattctcaatcttcactttgaagctgaaaaactattcgagggatgtgtccgtgtgttcaccgaactgccaaagcatttgtggcacaacgaggatatccgtataattcaaaatagctattacggagggaaaagcttgcgcggagctatgcagcatcactgcttcgcaacagatccagatgggctctactcttgtcataggatcaatgaggaggttgcggtgagtttgatgcctatgcctatggttatgccttcccatttttcagctctcaactcacggagccgtcaactttgtagttccggagaaccacgcgcccaactggagagcctcaattgcgctggtctcagcgatggattgtacgttttactggaaaacctacgccaaaccaaagttgatggacaacttcaactttgtgaacgaacagtacggcgcttcaaagtgcgttggctactttgcacatgctgatttcaagttttttgaggatatttactgtctggagagccgtattccaggtgtccgcttgtacattaccttgtaagtttagccaaatcccgtggcgtcaaagtgtcccattttggtttgatcttcgaaaaatgcgggaaaagagagacgcagacttttctactgattttgcgagtgtgatgacgtcacattttcctgtggggaaaattcccgcttttctggtagatcaaactataatgagacagcctggcaccacgtgcctaagcccaccacgcggttctggccttgtattttttgcgctccattgacacttacccgccggaggaaagccgtgtacttaacacggacaaatacatttagttttacaactaaaaccgagcagcgacgcgccccggccgtggccgagccaaaatggcctagttcggcaaactcttgcatttcaaattataagggaagccagaaccgcgtgtgggcgcccactagaactcaaaaaaaaggtcgaaaaaaatttccagcgaatcgcctgacaagatggacagcaagaaagagttcatgtccaagcttcacgagaagatccagacctgcggcgactggcacaccaccttcgactcgcccgtcttcctacccctatgcacaacctctacaccactttccctatacgcccacgcaaaagccagcgggctttcgagaatcttctccagcgaaaaatccgagcttctcgagatgaagagtattccggcacgtggtggtgcacgtcaattctccacactttacgatcactatcacaagactgtgtttgaagttcatgggtctgatccgaaggttgaaaattttatgagaaaacgtcctcgtcgaatgtttgatcaattctcgccggccagagctcatcagtgtgtggacgattcgatggcggagctgcatgggaagtatcagatgaaaagttagtttgacttggtagtaatgcctgcctgcctacctgcctgcctatcagccaacaagactacctatgtttgcctgcctatctagga