Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F15D4.1_f   

sjj_F15D4.1_fSequenceATTTTATTCCAGGGATCGTGTCT
Length23
In_sequenceSUPERLINK_CB_II
PCR_productsjj_F15D4.1