Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F15H10.4   

sjj_F15H10.4 RNAi (5)
PCR_productsjj_F15H10.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY32F6A.4 Source_evidenceePCR876WS150 Sequence/Annotation Release
Overlaps_Gene Y32F6A.4 Source_evidenceePCR876WS150 Sequence/Annotation Release
Chunk_score Abs_score773
Max_abs_score773Y32F6A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1043162210432673
Overlaps_transcriptY32F6A.4 Source_evidenceePCR876WS150 Sequence/Annotation Release
WB_DNA_textsjj_F15H10.41052ccacagcaattcgtttgagaagctgttccgttgtcagccggctgaaaaacaaattatttcgataccaattttggtactaattactattatttaccttgtgttggaatacagaaacatagcatggcatattaaactgcgtggttgttaattcaacgatggctgaaaatgtcgcgcatcctcctccaataagaccaattactgaaaattttccacataaaatgaatcaaaaattgaataaattttaaaaaaaacttactcataataataatgcaaatacaaagcgttggtttctggttaaaagtgataacatctctccatccaactggcccatttcctggttttccagtaatctcttcttttcttttataagcattcaaataaatataaaataagcatggcataataactgaagtgagtgtcaatgttgatcctccaaccaagtcaagaagtggtccaaatgttggaactgattcggcaacaaagacaacggcaaccattataccagtacgaacaatagctcgctttggtccaaatctctgtgggacatggaacaactcttcaacttcttgcatcagaggattgaagacaattgtgagagttagaatacaatggactgtgatcataatattaatggcctgttgaatccagacagtttgaattgatggaataattgaatcgcgaagcgagtcaccatataccaagtatcccataatacagactggaatgtacataaacgccatgactgaaaattttaaatgaatcggaatgttacaatcaaattgcttgagaacttacttgtgaaagcaagaaaaacggatctcgtgaactcttttggttgtttcatatcatgttgaattgttggaaaagcggaatgcccaccaacggagaaaagtagagttcccattgaaagaaacaggttggtggttctgaatggtggaagtttcgcgaatggagcacactttccatagtcgatgattgatccaacaataattagaataacagctgcagatgttgtcatcatggcaataacaacagcccacctgaaattgatt