Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F15H9.1   

sjj_F15H9.1RNAiJA:F15H9.1
PCR_productsjj_F15H9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF15H9.1 Source_evidenceePCR958WS150 Sequence/Annotation Release
Overlaps_Gene F15H9.1 Source_evidenceePCR958WS150 Sequence/Annotation Release
Chunk_score Abs_score874
Max_abs_score874F15H9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1215748312158653
Overlaps_transcriptF15H9.1 Source_evidenceePCR958WS150 Sequence/Annotation Release
WB_DNA_textsjj_F15H9.11171acctggagagccaaacacactaaattccgtgattcttgtgtctctggaatggagtaagttgattgatattgtgtgacgataattgatagttttttaatcattttgttaacacgtctttctctttcattgctcaaaaaaatcgtttcatcaaaaagaaattgtttcagagattccattgttccaccagaagtagtagctgatttgaagatttttgtttgccccaacggaaaaggaaaacattgccccccttcaattccaaagaaggcatggcttcatgggatctgcaagaacaacatcaagaaattattttcttcaattcacaccccaatgcttgtggaagttgaaacccccattccaggatcatctgtatgtgttcccgaaaagaaaactcaaattttggaagaaccctcttttgtttatatgtttataccatctaatggaagtgtggttgagaaacttgtcaatgtgagttaaagtagcataatataaatattatttaatcaattttttaactcagattacaaattctaactggttggaaattacaacacagttgttaggtggaattaaggagtattgtggaagtttaataaaaaagattcatggaaaatggacaatgatcggcttaggaaccccaagtaagttgctcgttctattcaacaaaaatctttggttaatttttcagaaaacgtgtggaaaaaacattcattcttcttcaacttgaaacggttctctggaagtttttgccattttgctggaatctgcgagaaacgcaaacaaaaaactactatagcgtccatcaaaacgacgacctcaattccatcaacttctacacttcaaatcaatcatacaactggctcaactgtgaactctacaactaggatgatttcttcgacaattccatcaactcccaatttgcaaatcaattctacgactagctcaattcaaaactctacaactagtatgatctcttcaacaatttcttcaacttcttccaattcaacatcttcaacaataaatgttccgaaaactgctgccccagaagaggagattgaggaagggcccagtgaagagaaagatgaaaatgttgatgagaaagatgatatcgagaatgaaacagaagtggataatgatttgtatgttagcatggattttctggacagtgccagtg