Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F15H9.4   

sjj_F15H9.4RNAiJA:F15H9.4
PCR_productsjj_F15H9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF15H9.4 Source_evidenceePCR714WS150 Sequence/Annotation Release
Overlaps_Gene F15H9.4 Source_evidenceePCR714WS150 Sequence/Annotation Release
Chunk_score Abs_score609
Max_abs_score609F15H9.4
Specificity_index0.851
Rel_score1
Map_statusUnique_ePCRI1214810212149238
F15H9.3 Chunk_score Abs_score107
Specificity_index0.149
Rel_score0.176
Overlaps_transcriptF15H9.4 Source_evidenceePCR714WS150 Sequence/Annotation Release
WB_DNA_textsjj_F15H9.41137cttgcgactgaaacgactgaagttgtagtcggggcgaaactgttctgactgggctccacaccacttcttgctgctattgttacagacgataatctggaaaattgtgtctgaagagcctgaaaaaaagtaaaaatactcaccccaaagctttcaatgtcttctctagcaatactgtgcgatatctaggattgctcagaatcatcaccgcactggagcacattgagtgggaggccacaaagaacatagagccagtggcgagctctggaaatgcataaaggtctaggtaggcagtaggcttctaggtaggcgttaggtctttaggtaggctttgaggtaggcggtaggcctgtcggtaggcggcaggcttcttggtaggctcaccttgcaatccaacttcctccattataatcacaaacatacaaaaactcaatggcgccacaagcaacacccctggaatcacaatttgcataattaagctgaaaagtgcagttttgtgcatttgatatgtttgacgagacatcgattttcgaaacttctgaagtataatcatagtgtggacaccaagggtcatggcgtatctgaatctttaagatttatagtagacatatatcttaaaaacttacgaataagccacgaaaatagtcgcaaaaactactgctccaagagcaaccagccatcgatttggatgatagtcgtagacttcaaaagcctcaaatttcagccattccaagcattgcggaaagttctgaaattgaaacaatctaggtaaaccaggcaaaattttaatttaataaagcgactaacattattcacgtaatccatcctttgttgcggggtaagttttgactggaacatgcaaaatgcggatgaaaatgggaataaatgagttaaaattagaaagagtttctccaaatataacttgctcgagtagccctgaacattattataatatttaaattgcaaaagtttctggcatttcgacaagccaacaattaccctgttgatattttttgtcgcattatgtctataaataaagcataaaagtgttgaaggaacttcaaatgagaaaataaaagtgtaaattgtaatactaagatgtgaacttataaattgtccgcctgtattgaaaccgccagt