Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F16A11.1   

sjj_F16A11.1RNAiJA:F16A11.1
PCR_productsjj_F16A11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF16A11.1 Source_evidenceePCR727WS150 Sequence/Annotation Release
Overlaps_Gene F16A11.1 Source_evidenceePCR727WS150 Sequence/Annotation Release
Chunk_score Abs_score643
Max_abs_score643F16A11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI93970289398189
Overlaps_transcriptF16A11.1 Source_evidenceePCR727WS150 Sequence/Annotation Release
WB_DNA_textsjj_F16A11.11162cgcacaaaatccctcttgttttgcaaaccaatatcttgaaacttcttcatttttcaaatattcttccatttttatcaacggatgagtcgtcatttccgtgaacattttgcatattgaaatttggttttctcgggtttgagcgaatttttcaagtgccaagagggcaaacattctcacacaatgagtgttcttctctttctgaatttgttttttgttgaaaaatcttcatttagaatattaattcttaccagtgttttcccgtaattcggtggaaagtaggtaagcccgtagcaaataattttcatcaaataccctttaattttatcgttaaacattgtaactgccgcgcttccagccattttctcggcaagggaaccaagtacaatacacatatttttgtgccatgatggtggaagatgctttgaatccacaaattcactacttaatccaagagaaagaagaagagtttgtactgattctctacttggaagtggacattcatcaaggaataatgatattactgcagggccgagaggatcgttttctggtatctgaaaaataaaaattatttttttggagaaaccttttggagaaattggatttttttgtgacgaaaatcgctgtaaattttcaaaataccataatgaaatatcaaaatcttcagagttttttaagagttcggatagacaacagtgatattttttttcacaaaaaacatttactactacagaaatcagttttttgattattcttttgtttctcagattttttaagtcgacattgctgaatttccgaaaaattttcgcttgccgttctgtcataataatttttgtttttgtctgtgaattgctatttccagtcgaaaaaaagcttaaatatgaaacatactgtgtagatcaacgctcgtacaaccattgtccaccctttctcctcgtcagcaataaagttcaatttgagtagtgattgaggtggttcttgttcactaaaaaattgaattttcattgaaaaagttggactttcgttttcgtacttattaacaagtgttcgtatgacttccaaagtctctataataagttctttgatatcatctcgaacatcaccatttcccccttccgatcgacttctatgtccatatctgtgaccatttgagaaaggatcccga