Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F16H6.10   

sjj_F16H6.10RNAiJA:F16H6.10
PCR_productsjj_F16H6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF16H6.10 Source_evidenceePCR487WS150 Sequence/Annotation Release
Overlaps_Gene F16H6.10 Source_evidenceePCR744WS150 Sequence/Annotation Release
Chunk_score Abs_score658
Max_abs_score658F16H6.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1822521518226659
Overlaps_transcriptF16H6.10 Source_evidenceePCR744WS150 Sequence/Annotation Release
WB_DNA_textsjj_F16H6.101445tttcgaatagacaagggatttgagaatagtaaaaacgtgaaccagagtgtaaaaaagtgttaaaaattagaaaaaaaatggctaaaaagtttttttaccctctggataacctcataaaactttattcatttcgttaattaagacaaatacaaatgcagagaagataagaaaaaatagacggtatttagctgacaccccgcaggtcagtttttttgtttttttggtttttagtgttttttggaaaaaaatctttttgtaattaaattacgtgtttgaacaattcaaacaaatcaccacaaatagaatagaatattggatgagattattaaagtttaagactaattctttttctgagtatttagaggagagtataaaaattttaagagttgttgttatccgataaatcctggagtcttttacaaactttccgagtgacgagtctgaaaattcatcaactaatagttttgcttaactaactgagttaccggaaagtcagataatgtagtgttagagctgaatgtatttttaacggtcacttggtcagctcccaaatttgatgattgacaacatttacctgtgacttcaaaactttcctgtattaagcttttgtcaattggctaaaattaggatcattataagattgaggtaaaaaagtaaacggagggcacttacatattcatcggagaacgccagaatatatgtgaataatttcgtcgtgccataaaaatcgtgaagttcaccattcactaaattttccagcattacaagttgatcatcagcataaacattttgtaatgaattatcgatgggtaatgtctgaaacagcagaaatatttgtgtgaaggtttgtgtggctgtaaatgggtatctcggtaatcgaaaacaaaatccgaaatcgaaaacctcgaaaacatgcacggttagatattttttttagttaattttctgaaagagcatagttgaaaacatttttcggtgcaattttaaaaaatttgagggtatagtttttcagaaaaattaaattttgtcaatatttttttattccgaatttttgaatttcacttggaattttgtaaaataagttatttgttacggatttttttaaatattaaaaacaacattacaaaataaacatttcaaactaggaatttcacaagttagaagtgaacaatttatttgaaacagctaatcaggttcttaagttacgccagttttggccgaaggtactctgaaaaaaaaagatgttctgaaaacttactttttcaaatacacacttgtcatgatcattcattgcattcaattttaatgtcttgaatatatcagaacgacagctgaccactaccgaaagtgcgtttggcattgatgaaatactccgtaaagttagtgtaaaatcgttcacgatcagagaagacggtctcaaatcaagaatccgtttgagatgtttc