Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F17E9.10   

sjj_F17E9.10RNAiSimmer:F17E9.10
PCR_productsjj_F17E9.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF17E9.10 Source_evidenceePCR373WS150 Sequence/Annotation Release
Overlaps_Gene (11)
Overlaps_transcriptF17E9.10 Source_evidenceePCR380WS150 Sequence/Annotation Release
WB_DNA_textsjj_F17E9.10678tgaagactcacgaatgagatgaaaaaatgaagaaatgaggctgtcttttataccagctgcggtggatgtaggagggatcacattgaaccatcctgttaggacacatggtgtaccactctctcactctctatctcttccattttctgtagataggtcattcggttagaatgcaaacactgagatgtgtccctgcaggggaatgaatgaggtctccgccttctcaccccaatattacacttcttcgtataaaaggggacagactaaaggttttttcacagtcccctcggattttcatctcaaacgcaatggctcgtaccaagcaaaccgcccgcaaatcgaccggaggaaaggctccaagaaagcaattggccaccaaggctgcccgcaagtcggccccagcttcaggaggagtcaagaaaccacatcgttaccgtccaggaaccgtcgctcttcgtgagatcagacgttaccagaagtccaccgagcttctcatccgcagagcgccattccagcgcctcgttcgtgagatcgctcaggatttcaagaccgatcttcgtttccagtcttccgccgtcatggctcttcaagaggctgccgaggcttacctcgtcggactcttcgaggacaccaacttgtgcgccattcacgctaagcgagttaccatcatgccaaaggata