Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F17E9.12   

sjj_F17E9.12 RNAi (3)
PCR_productsjj_F17E9.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF17E9.12 Source_evidenceePCR300WS150 Sequence/Annotation Release
Overlaps_Gene F17E9.12 Source_evidenceePCR300WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV83336668334153
F54E12.3 Chunk_score (2)
B0035.9 Chunk_score (3)
F22B3.1 Chunk_score (3)
Overlaps_transcriptF17E9.12 Source_evidenceePCR300WS150 Sequence/Annotation Release
WB_DNA_textsjj_F17E9.12488tccgtacaaagttcttccttgacgcttcagagcatagacgacgtccatagcagttaccgtctttctcttggcgtgctcgcagtaggtgacagcatcacggatgacgttctcaaggaacaccttcaagactccacgtgtttcctcgtagatcaatccagaaattctcttgactcctcctcttctggcgagacggcgaattgctggcttggtgataccttgaatgttatcacggagcaccttgcgatggcgcttggctcctccttttccaaggccttttcctccctttccacgtccggacattgttgagtgattgaattgaagactcacgaatgagatgaaaaaatgaagaaatgaggctgtcttttataccagctgcggtggatgtaggagggatcacattgaaccatcctgttaggacacatggtgtaccactctctcactctctatctcttccattttctgtagataggtcattcggttagaatgca