Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F18A1.5   

sjj_F18A1.5 RNAi JA:F18A1.5
Simmer:F18A1.5
PF:GL1_5G7
PCR_productsjj_F18A1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F18A1.5 Source_evidenceePCR972WS150 Sequence/Annotation Release
Chunk_score Abs_score867
Max_abs_score867F18A1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII76648987666054
Overlaps_transcript F18A1.5.1 Source_evidenceePCR972WS150 Sequence/Annotation Release
F18A1.5.2 Source_evidenceePCR972WS150 Sequence/Annotation Release
WB_DNA_textsjj_F18A1.51157cgatgaccaaatcaaacgtgaagttgagcatcttgttgagggaacaattatcgctcttactaaatttgaaatctacgaccaagggtgagattataacattattgagtccttcaatgtatttttcagagaaggtgctaagaattgcttcctgatcaaaggatacaaaattctttctcgctatcatcaggttttgacctctccagaagtcaagccaagatctcattctggcaaacctgatgagcacaaaggctatagaccaaatattatcatcgaagatgtttggcctgaagctgaaggaatggctgctgattaccaggagaatatggcaaatccaccagcagcaaaagcgccgaaaagagaattcggagaaggtaaaatctaagagttgtaatgtgtgtaattcgagttttcagaagcctcatacaatcgtgccgctgctccagaggctacacgcgctcgagctgttccaccaccagcacgccgtaccgcgtcgaacacagaaagaggcgtgatgcctattgcaatggttacaccgtacgtatcgaatttcaaaattcacggaatggtatcacgcaaggaggaaattcgtactttcccagcgaaaaacacgaaagtgttcaactttgaaataaccgattcaaacggagatacaatcagatgtaccgcattcaacgaggttgctgagtccttgtacaccacaatcaccgagaatcttgttagtattattttaatcggattatgcataataattaatttaatattttcagtcttattatttgtctggtggatcagtcaaacaagcaaataagaagttcaacaatactggacacgactacgagatcacacttcgcagcgattctatcgttagtaaatttaaagcgattcatcatagctaaaatattaaattttcagattgaagctggaggtgaattgcttgctgctccaaagctcatactcaaacgagtgaagctaggtgaaatcgctggatatgctggacaactgattgacgttctcgtcgtggttgaaaagatggatccagaggctaccgaattcacttcaaaggctggaaaatctctgatcaagcgagaaatggagttgattgacgagtctggagcacttgttcgattgacactttggggagacgaagcaacaaaagc