Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F18C12.2   

sjj_F18C12.2 RNAi JA:F18C12.2
Simmer:F18C12.2:Screen_A
Simmer:F18C12.2:Screen_B
PCR_productsjj_F18C12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F18C12.2a Source_evidenceePCR1036WS150 Sequence/Annotation Release
F18C12.2b Source_evidenceePCR1036WS150 Sequence/Annotation Release
Overlaps_Gene F18C12.2 Source_evidenceePCR1036WS150 Sequence/Annotation Release
Chunk_score Abs_score994
Max_abs_score994F18C12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80870568088160
Overlaps_transcript F18C12.2b Source_evidenceePCR1036WS150 Sequence/Annotation Release
F18C12.2a Source_evidenceePCR1036WS150 Sequence/Annotation Release
WB_DNA_textsjj_F18C12.21105gaagtttgaccagcttcgagttactgctgaagctggtttggaaagatttgtgcagcactgggatctcgaacaaaaactcaattttcttccaaaacgagttattgatgagaaacaacaacaaagacagcaaccggttgtcctgagaaaacgaagaaatcgagtacggccaaatgttaattggaaactatttgcatatcaattctcgaaggatcactctcaggcagatttaatttggaatgagaagacgcgagaagagttccgtcatgcaatggatacagaaacacgagctcttatcagtgaaaaagaacaagcaccaactggattgccgattgcttggaatcatactgagttccaaatcagatatccatcacttttagaagaaattaaaattggagattattaccttcgattgcttctgattgaggcagacgaaaatgcgactccgattcataatccgtaagtttaaaaaaacgttgtagatttaatcatgttctttttttcaacaaattgtacgataaatttcaggctggagttcttcaacaacgtctatcatcgtttcctactttccactaaagttgacatgaaatgtctgtgccttcgtgcaatggctatcacctattctcgacatcatatgacaatcggagcatttcaggattcaaagtatttcgtagaaatgcttcaaaaatgcataaatccgttggaaagagatcatcttgtgcttctgttatcgaaactagcactgaataaggataatgttcgagaacttataatatccaatattcttccacttttggtagatctttgtgttcttgcacatttacacgtgcagcgagcaaaagttcaaaatcagacaaatgtgattgaggcaagtgccgaacaaatggctgaaggaggttctgaagaatggtattatcatgataaggatgctaaacaagtcggaccattgtcatttgagaaaatgaagtctctttacacggagaagactatttttgagaaatctcaaatttgggcagctggaatggacaagtggatgagtttggctgcagttccacaattcagatggactgtttgtcagcaaaaagatcagccgaacgagattaataca