Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F18E2.5   

sjj_F18E2.5RNAiJA:F18E2.5
PCR_productsjj_F18E2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF18E2.5 Source_evidenceePCR822WS150 Sequence/Annotation Release
Overlaps_Gene F18E2.5 Source_evidenceePCR822WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678F18E2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1275563412757243
Overlaps_transcriptF18E2.5 Source_evidenceePCR822WS150 Sequence/Annotation Release
WB_DNA_textsjj_F18E2.51610taatggaatgacgctgagtttttcacagaaaacatcaatttcattcaaaaacaaatagattggagttgttgcaaacgctgggtcttcactgattgattgcaacaaattcagagcgtcatctaatcgattctaaaattaataatttatagattcctcttacgaagtttgaaattaccgtaaccatatcctcgctcatcacttgatcatattcagaaattgcgatgcaaaagaatattgcatcaatcccttcatattgtaaagcccacttccgtctatcaattttctgtccaccaatatcaaataatctgtaactttttttttgatttccgcttcaattcctcaaaggaaaatgtgactcactgaaaagattgattacaagcagtaaatatgacattttgaacaccacaagttggaacataagccatgatgagatctctttcagacggcttataatccaccatatttatcttatcgatattgttaagaaaactgcaattaaaaatggtaatcttctggatgaaaaggattagtttcaaaaagtctggaaattattcttgcacttgtgaaaagcgcaaaattttgctcttatgatcataaatgttctgaattcgaaagacagggaaatgcaactcactaagatgctgaatcattcaaattaaattgactccgtcgagcgtaaagtttttgcatagatttgtcattccaaatgtgttttatcttttcagccaaatcttttgagaataaaccataatgaccatgttcatcagctattatggattgagcacgaccctgcaaatatatagatgagtttttcgtaatttcttttaggtttcaatattatagttcaagttccctcatttttagaaattgataaacggtcacgaagaccaacttatttaccaatttacgaaaaaaaaagcttcgatgtaccgtatttttcctattatatttgcgccctcctttgttttactttaacggctcatatcttggttgttttaagtcttatccacaaaaaaattactgtgaaaatgtagaaaaatatttttcaggtattatgtcagttcacaattttttgttaaaacaaaatccaactgagatatgatctgtcaaagtagaataatactgaatataaatttaattccaaattctttttaaaataataataccatattgattgggtctgcaaattgaatatcggacattctcatggcacgacataacgctttgatacttttgaaaatattgtgatagatgaatgcacgtcgatgaaaatattcagactctgtgaaatgttgtttatagagcaaccggacttgctccaaaacggttgtttttccgctttctgcggatcctgaaatgaatagaattggattaaaatggaattgaaaatgaatacaaatttaccgagaagaagtagtctaatatggctgtatggatcttccgatttctgagaagcgggagtaattgaacgagatgcacgaatttcgggaacttggagctgaaaatagacatgaattgaattgaggtgatctcaaaaaattgattataataacggtggcctcctataattgcttcaaaatacataccgcaacttgtggagaaatagatgg