Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F18F11.4   

sjj_F18F11.4 RNAi (6)
PCR_productsjj_F18F11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF18F11.5 Source_evidenceePCR949WS150 Sequence/Annotation Release
Overlaps_Gene F18F11.5 Source_evidenceePCR949WS150 Sequence/Annotation Release
Chunk_score Abs_score844
Max_abs_score844F18F11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV328569329690
Overlaps_transcriptF18F11.5 Source_evidenceePCR949WS150 Sequence/Annotation Release
WB_DNA_textsjj_F18F11.41122ctggcggatccttttattgaaggtctcccaagtgctcaaaaacgtcgtgcccttctagcctcaccaccagaagcgttccggtcattagagtcctatccatgtctgacaccatcatcagatatctggtcagtcggatgtgttcttgtcacgatgctcactcgatatcctccatttttggagcattacatgcattttcacggagagagcttgcatagagttagatttcaagcagtgattaaaaattaatcgagtaatttaggagctggtttctgaatggtgtacccgtcgtcaattgatatactcttcccaaactttaattccatcggcatcgaaagaaatttgtgaacttattgatcaaatatttaacgtcgatccagaaaatcgaccatctgcacagaatctcttggaatctcatggatcaaaatcaaggaaagcctcgttaagaaattcattggcttcacttaccacagctaaagagccagatcctccaaagccgatagatgatttttatgtggaacgggaggacgatgaagagcatcgaaaaatcgaagagttgagagaactggcggaaaggggaaataatgaggtaagattagactgaaggtagaaaagttttacatttgaaaattccagggtggcttcattccatttatccgctggtatatgtcccgaattctaatattttctgttctcctagtcaaatggattggaatggtgttatgcgcggcattgagtctggcggctgttgccggtggtgtattttttgcaatttttttgatttacaatggaatccaaattgcgtgccagtgctcattgaatgaaggtaagaaatgaaggtatatgaaattccatatttaaccttaggattcgttgttttaattgctttgattctgctaccaattatcattttgctaactacactttgctgtaataattctctggacagatatcacgctgatgtggaaagtggaaaagtggaaaagtttgttacaatgaaattcccacagagaatattaatttttagaagccgatttgttatgaaaactcccgaaaaggatgtaattgttggaggatatatacttgtggaaggaagtccagatcatgataaacctgcggaagtcc