Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F20D12.1   

sjj_F20D12.1 RNAi JA:F20D12.1
Simmer:F20D12.1
PCR_productsjj_F20D12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF20D12.1 Source_evidenceePCR1074WS150 Sequence/Annotation Release
Overlaps_Gene F20D12.1 Source_evidenceePCR1074WS150 Sequence/Annotation Release
Chunk_score Abs_score1019
Max_abs_score1019F20D12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV79594827960644
Overlaps_transcriptF20D12.1 Source_evidenceePCR1074WS150 Sequence/Annotation Release
WB_DNA_textsjj_F20D12.11163cagtacgcatttcctcgtgattttccgccaaaccgtatcgttaatccaaatatgaaactgcaaagagccgtgaaactattgttgaaggatttaaaatgcaacccatattacgatgacaaacagatttgggctacgaacactatcacagtgtcggatgttgactacaacgcgccgaaagatccagaattcagacaaaagtatccaaatctgaaattcccaatgcttcctgcagttcaatgcggcactggaccacacaagcgcctcatgccgctcgaatatttgaaggttcttccttatcaatccattgaccgccgtgtactcgaagagtttgagcttacagtaagtttaaatttttcatatatgtcatcttaattcaacttacagccacgagcgaatgccccgaacgaacgctggtcaactcttcaaaaacactacgatcaatttggtttcaacgatcaagtcatgaaagattttggtgtccaaatctgcaatgatcctttcaacaacgtcagtgagatcgacggtgaaagagtcctcgcgcctagtgttgcatatgcagacccggtacacgtggatgatgagaagcgtgactggaaagcacaagacaaaaagtttgttacacctgctacgattgaccatttgatgttcgttctagtagcaggttatactcgaacttgggatgctgattgcgatgcaaccaaatttgtcgcgaaagcattcatgcagcgttgcaaggacaaaggaatgcacattggcagttatagcatggatcagcacaatggcgaacgaggcagcgaaaatttccttacttcggtcttcaaaaacttggtgactcatccaaactaccgggattcgtctttcactccgttcgtcttgtttatttccgatgacgttcctaacattcatgagtgcctcaaattcgaagagcgtatgagtgacattccaacgcagcacgtacttctcaaaaatgtcaaaaagatgcgtgacaacatcgaaaagaagtctcaaggtggaagaagagcatatgatttgactcttgacaatattgtgatgaaagccaacattaaatgcggtggacttaactacacagcagatattccaagagagttagttgggcgcacatcatacattattaaattaatttttacagtcttgcgtgctgg