Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F20E11.9   

sjj_F20E11.9RNAiJA:F20E11.9
PCR_productsjj_F20E11.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F20E11.9 Chunk_score Abs_score622
Specificity_index0.183
Rel_score0.23
F20E11.3 Chunk_score Abs_score72
Specificity_index0.021
Rel_score0.027
F20E11.13 Chunk_score Abs_score2700
Max_abs_score2700F20E11.13
Specificity_index0.796
Rel_score1
Overlaps_pseudogene F20E11.9 Source_evidenceePCR727WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1745365917454810
WB_DNA_textsjj_F20E11.91152cgttccagtctcagtgcaaacttatgtgggcctttctttacctgcaggtcagttcttctttgagaaaattgatatatcattctgcaaataacgtcaaccatggcaacagcctgaccaaaattcttaaaagggattcaaagttaacgtatgaaaaagtgtgaagacggagtcaaactgaattgagaaaatcaattttgcagtaatggtagcgaccattgtggtgtttcttgaagatcgtcgatatcgtttggttaacgatcaaaagtcaagcaaaataaaaaaatggtttcggttgttgtttattacagcaaactatgtttctgctacaatgtaccctgcgccggtattctttttccttcctgatcaagaatatggaagacttttattgaaaagtttttttcaacatttacattacaatacatttttcaccgtgaaccgtggaggtcaaaattgtataaaaaatctgttgtgaaacgttctcatttttaaaatgtttctttgaaagttcttgttccagaaaaatcagtgtattccaaacgtttttttcgatcatccaaactttttttgcttgttctcgatggtgagtatattgccaattatatgctatttgcgttgactatttttttgtctcaaatgttttggcaaatcgggatgattttccgtcatttgcttaaaagtactcctgtttctaagagcacaattcgtttacaacaacagttttttatcgcaatgagcctgcaagttatcattccaattgtcataatcgcttttccatcgttttatatgtttttttcagttacatctggttattataatcaaggtatttatttgttcggaaaaatattagacatcatttcccaattctaggcgctaacaacatagtgtttactgtaatttccatgcatggagtgttatccacttgtacaatgaggatggcatacagaccttatagagaatcaattgtccaaatgttgaatctgaatttcaaacagtccggtagccgagctcaacttatttggaagctttcaaaaagaacaagtactcgattttgatatgcaatatggtgtagtcgacaagccaatgcagttggagagcctaaattctttgagagactacagtacttcctctttttttatttgtttccaaagcggc