Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F20G4.2   

sjj_F20G4.2RNAiJA:F20G4.2
PCR_productsjj_F20G4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF20G4.2 Source_evidenceePCR816WS150 Sequence/Annotation Release
Overlaps_Gene F20G4.2 Source_evidenceePCR816WS150 Sequence/Annotation Release
Chunk_score Abs_score774
Max_abs_score774F20G4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79169367918026
Overlaps_transcriptF20G4.2 Source_evidenceePCR816WS150 Sequence/Annotation Release
WB_DNA_textsjj_F20G4.21091gctatgcaaagccgatgaataaaaattagtgattgaaaaattgtcgtgtcgagaccaggtaccgtactttcagcggtaatgtcgcaacatttaacagctaaaaactacaatcatatacaaaaacacaagaatgcacaattctcctcgagtagtaaagctgcgtaaatcgacacttggccaaattagactctctcacgctcattttttcatttttccaagtatgtacaaacctgagtttcatcatctggtccagcacaattagttgattctataaacacagatggaccacaagtctcaatatcaattgcatattctcgaaatacactgttttgtagatgcaatccacagctttcttctatgaaatgctccgttttttgataatcattattataatcccaagttggttcatcaggttccgcgaatctcagtttcttttctggagacttctttaagcaatttacattcaacttttccacttcttcaaactcttcaaatctaaattgtgaaccaattttttcaggcgatacctcaattttgaatggagaagcttccaaattgcaattggctacttcaaatgcttcagattcttcgtagatgctcatcggatcctctacatcatcaaataaatccggagagttctttccgttacagtaatcgaaacatataggaggttgagtatcttcaaatgcggtaaactgagcttcatagccagtgataaaatcgagtgagaactttgttttttgtggtgagtcgatggtttttattggggaaaatgtgtcaaaaatgtttgaaacttctgaagtatcagatttttgctcactatccgaagaatcggatttatcctcttttcgccgtttcacagcctgcacaacgtctgcagatcttcgtcgttttggagtcaatgctgcgaaatattgttcaggactttgacggatttgaagaataggtggagaaaactttgtcggatggcgcgctgaaattaaagtttaaagtggaaaactaactatcttgatctaacctattttaagaggtattacaggtgtaataattcggatttttgccatgctagaagtgggagttttgatttccga