Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F20H11.2   

sjj_F20H11.2 RNAi (6)
PCR_productsjj_F20H11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF20H11.2 Source_evidenceePCR1136WS150 Sequence/Annotation Release
Overlaps_Gene F20H11.2 Source_evidenceePCR1136WS150 Sequence/Annotation Release
Chunk_score Abs_score1094
Max_abs_score1094F20H11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII65950256596210
Overlaps_transcriptF20H11.2 Source_evidenceePCR1136WS150 Sequence/Annotation Release
WB_DNA_textsjj_F20H11.21186gtgaaacttctgcattcgcatttcttctctgatacattacatctccagtttcagaagtcaccatgtgtccacgtcttccagtcatttcagcaacatattccggtccacccatctcatcaattaattgatctaaggtattagctggaagggacggagcaagtctttcgacggcagcaagaagttcagttttaataagcataggattgatgtcatcttgttcacccgatccatttccacagattctagatgaagtgataaaatccgtagcagatccgcgtgcttgaagctcttcatttcttcgttgtttctctctttcagcccttcgaatagctctccgccgcttcttttctcgtctttcttcacgttttcggactttctcgcgcaatcgttcagcttcctcttcatctcgttttcgttttttagctttccgatctttttgaggggtatcttcgacaatttgttgattgtgtgcccatggatctgaaaaattacgatttatgtaaatttgacaaatttcaaaaataactcaccatcgtttgtaaaatcacacataaacggattaaactcttcctcttgttcgtgcgtctccccactttttgactcagcttcttcatcttcatcctcatcttttaccacctcttcatcactatcgtcacttgatgattcagcttctgccagcagtgctttaacccattcatcttgttctccatcttccagagttctagctccttccgcttcttctcttgcactttccaagtctccactttcaccaccattctccgaaatcatgtcattttccacttcatcatcggatccatcagaactttcactggttgttgagttggcatcttcattattagtatttcctgtcgatgatgacattgaagaccttccgataccactcaaacctcttgttatattctttgtgacgccatctccaactcttccacccattccagttgtcacaccagtccaagtatcaaaaccaacatctccgaggaagctcaaagtttctcgtgttttccttcgttttgcaggtcgttcgaagtcatcaaaatctttgaaaatatctctatcgcccatagaaaatgatgcatctgttgggaaatgtttgtcgatgagaccataaagcaccgttttggcagtggaaacaaactcattaagctctccacccatttcctcaaga