Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21C3.3   

sjj_F21C3.3RNAiJA:F21C3.3
PCR_productsjj_F21C3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21C3.3 Source_evidenceePCR393WS150 Sequence/Annotation Release
Overlaps_Gene F21C3.3 Source_evidenceePCR393WS150 Sequence/Annotation Release
Chunk_score Abs_score330
Max_abs_score330F21C3.3
Specificity_index0.835
Rel_score1
Map_statusBest_ePCRI72796877280635
F21C3.4 Source_evidenceePCR86WS150 Sequence/Annotation Release
Chunk_score Abs_score65
Specificity_index0.165
Rel_score0.197
Map_statusBottom50_percentile_ePCRI72796877280635
Overlaps_transcript F21C3.3 Source_evidenceePCR393WS150 Sequence/Annotation Release
F21C3.4a Source_evidenceePCR86WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21C3.3949acatgatgccacggtttaaaatagttttggaaataaatataaatataattttttactgatttgtttacaagactgataatgaattagtggcagaatgtaagcaatgcaatatttatccaggtggccattggagctgacgtcctcccaaaacgtggagatgaagatggaaaactgattgagctccatcttttccattgttcacaacaacacggtatccattggccatgccgagctgctttgcaacctggaattttatttaagagtaatataatggagatttctggattttcaaattcgtttttactcatttataattacctttgaagcagtaaccataagctttccaataagcgcagcatccgaatcaacggcattctcgagcatatcaatgcgacgcttagggatcacaagaaaatgaattggagcttgtggagagacatcatggaatgcgagagccttaaataaatattttatgtgatcgtttgcctgatcttacatacctcatcatcttcaaaaatgattttcgctggaatctcttttcgaattatttttccgaaaagagtgtcgttggcttgaacatctttgttaattgccgccaagtgggctttatctacttccgacatgtttctctttgtaaacctgaaaaatggtggaatcgataaagacaccttgcctacagtaaccctgacctaactggattacggtaagcaagacgcaaagcggttttaaccaaagaggaagccatactaaaatattgaaaaatgggcaaaaaataaccaatatgcaatatatttcaaacgatgaaaacgctagacaacgagaaataaacaataaacatgtgaaaataaatgctttaatcagtaaaatgatacaaaaaataatcaaaaaagttaacacaagaacaagaattaatgtaccagaatacaatttgaacccataacgtgatttg