Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21D12.3   

sjj_F21D12.3 RNAi JA:F21D12.3
Simmer:F21D12.3:Repeat_a
Simmer:F21D12.3:Repeat_b
Simmer:F21D12.3:Screen
PCR_productsjj_F21D12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21D12.3 Source_evidenceePCR995WS150 Sequence/Annotation Release
Overlaps_Gene F21D12.3 Source_evidenceePCR995WS150 Sequence/Annotation Release
Chunk_score Abs_score890
Max_abs_score890F21D12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII73209857322182
Overlaps_transcriptF21D12.3 Source_evidenceePCR995WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21D12.31198ggaacagtcagtgcgacaaaaagaaccaagaatagaacaatagttctagtaataactcttccaattccaaaggcatgtgagatctttgcataatgttcaacttcttgatttaatggattaattacaattacaagagtcattatacaatgaaatgagatcatcaaattggcaagaagctgaaaagatttcgaaggtattgattggtttttgttaaatttcattacctgcaatgaaggactttgaatactgtaaataactgaatcagtcattgaatctccataaaccacaaatgcaaatatacagagtggaagataaagaatgacaacacccaagaatccagcaaatatcgattttgtgaaatctcttggattcttcatatcgtgttgaattgttggaaatacgtagtgcccagagaaagcaaacaaaaagattccaaacgaaagaattgttgatgtgcttgttgtcactggatatgatacagctgagaaacatgcagtcgagtccaaagcaattccagtatggattgagacaactgcgattactgtagtcaacatggcgaacacaatgacaaccctggaagttgagtatttgaataattgaatttgatttgataacaaaacaaaaaatcgtttaccagaactctcctggacttgccaacaatgtgaatggccaaatgaggaatgcaagtacagtaattacctgaaaatggaacttcagatcatattattttggaataaaaacttactaaacagttagaaatgctatcaacgtgtagaacatggctaatgaagaaatgaataatatttgctgacagcagaaggtatacaactgatacaccaaattgagttacattaccaagaactgacgtgaaccgtctgaaaatatatcctttagcggatataatagaaacaataaaaacgaactgcatattggttcccattgttctttttgccatctctggaaacggtttccggcagacaccaatatgtggattcctctccattattttgttccataccttaccgagaaggtatccagtgtattcgaaactaactgctacagtaagcattataagtatacccattggaagtccagacaatttgaatgcgacaggcattgctacaactcctcctccaaccatatcggcaatgataaatattgctgcgatcacccatccgattttgtgcttcccaggttg