Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21D5.1   

sjj_F21D5.1 RNAi JA:F21D5.1
Simmer:F21D5.1
PCR_productsjj_F21D5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F21D5.1 Source_evidenceePCR991WS150 Sequence/Annotation Release
Chunk_score Abs_score907
Max_abs_score907F21D5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV87267548727929
Overlaps_transcript F21D5.1.1 Source_evidenceePCR991WS150 Sequence/Annotation Release
F21D5.1.2 Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21D5.11176aattcggaatcaaacgatgctgagctgttcgacggtgacaaaattgcagttctgattgtcacatacattcgggagcaactgaaggtgatttatttcaaaataatagttatcaaattatgaataaactgagtgtgaagttttcaatgatgcatcattctaggattacgaaaattccactccgatggaacgtctccgccttggtattgttcaaacagcatatgcgaatggaagttcaacacgctacattcgtgaaaagttgggtattgagccaattattgtacctactggagtcaagcatctgcatgaagctgcttctgagttcgacattggaatttatttcgaggccaacggacacggaactgttgttttcagcgagattttcgaccgcatcatcagaaggtataggagactaaacagcttcataaatttcttttttttcaaatatagaaatgaattgtttcagaactccaactgaatcattacctctccgtcgtctagcacttttctcccgtgtcatcaatgaaactgttggggatgcttttgcagatttgcttgccgtggaagctgttctccgtcactatggatggtctatggatgactgggccgaaaaactgtatcgagatgttccgaatgtgcagatcaaagttccagttattgatcgttccattttcaaaacgacgaacgccgagcaaactcttgtgaaacctgttggaattcaaaaaatgattgatacggatgttgcaaagtacaataattcgagagctttcatcaggtaatcttatctgaagtttttgtttcatattcaaatcgatttcagaccatctggcaccgagaacattgttcgcgtatacgctgaagcggatactgttgaaaatacattgcaactcggaaaatctctcgaacaagtcgttctcaacctttgcaactcgaactgaagaaaataaattccatatgtagtctcgagttttcacaatgtatttttattcatcccttcagtttagtcattttcagcataatctcccaaagttttttttaaatttttccctttcatattcccatatttatttgttaaaattcatttatgagtttctactggtttccccatttccctatatcaactttcaacggttttaaagtaaattcctggtttcattaaaacacatcattggccctttc