Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F21D5.1_f   

sjj_F21D5.1_fSequenceAATTCGGAATCAAACGATGC
PCR_productsjj_F21D5.1