Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21D5.8   

sjj_F21D5.8 RNAi JA:F21D5.8
Simmer:F21D5.8
PCR_productsjj_F21D5.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F21D5.5 Source_evidenceePCR175WS150 Sequence/Annotation Release
F21D5.8 Source_evidenceePCR381WS150 Sequence/Annotation Release
Overlaps_Gene F21D5.5 Source_evidenceePCR195WS150 Sequence/Annotation Release
Chunk_score Abs_score132
Specificity_index0.293
Rel_score0.415
Map_statusTop50_percentile_ePCRIV87390418740181
F21D5.6 Source_evidenceePCR32WS150 Sequence/Annotation Release
F21D5.8 Source_evidenceePCR381WS150 Sequence/Annotation Release
Chunk_score Abs_score318
Max_abs_score318F21D5.8
Specificity_index0.707
Rel_score1
Map_statusBest_ePCRIV87390418740181
Overlaps_transcript F21D5.8 Source_evidenceePCR381WS150 Sequence/Annotation Release
F21D5.6 Source_evidenceePCR32WS150 Sequence/Annotation Release
F21D5.5 Source_evidenceePCR195WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21D5.81141tggaaagttaaatctcgccaataaaataatgtgaccaattcttacccatatcgaatgcggcaattttctcttttccttcacattctgaatgggtgaaaatcatcaaatcgccgttgtcctggaaaaatcagactttagttttttttaatgaagtttatttttgaaacctttgattcccaggatccagtctttttcagtggtcgtccaaataaatcagtatctgtaaaccggagatgaactttttcagataaattgcaaaatcgaaacctttagattttttcgcttcgttttttgctccatccattgctcttttcataattctaagtctgaaaactgctgaaaaaagcaacgtctgccaattatttgtggagcaattaaaaagaaaatcaataatcgatattttctgtgttaaaaactttaattttattggaaaaatgtagcaaaacctcaaaaagaatttattttcaattaaaacaaacgtaaaaaaaaaatcaacaaaacttctaatctagatttaaacttcgagaacatccacactacttctttcctctcaattgtgcacgctttccttgaccgattggtggccgaacaacttttccgcgaataattttcaaattatcttgaacatctctgaaaactacgtgatcatcaaaaaatagtccatggaatcgtagcattttggtcaaataatgaaacatcggaagatttggatagtatttcggtgataattgttctttggtttcatatggttctgcagacattactcggacaacctgtaaatgaaaattttcagaaacttttctttataaaaatcatctaaaaacctttaaacttttagtgtcagttggcatgacaacctctccccatactcgatttgacaatcgatccattcgttttccgaatggtgtaggttgagagattccgcggccggcgtgcacaattcgtgatgcagccagacgtgccgccatcttaaaatattttttttattgttgatccgttaaaatcggatgaaactgttaaatatagatataaataggcaaaggacccatttcggaaggagtattctcaatcgaaaacgtttcaaagtttcagttatttagtacacgaattaaaaaatgtgtgaaatgcaaaattgagattg