Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21F3.3   

sjj_F21F3.3RNAiJA:F21F3.3
PCR_productsjj_F21F3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21F3.3 Source_evidenceePCR853WS150 Sequence/Annotation Release
Overlaps_Gene F21F3.3 Source_evidenceePCR877WS150 Sequence/Annotation Release
Chunk_score Abs_score772
Max_abs_score772F21F3.3
Specificity_index0.728
Rel_score1
Map_statusUnique_ePCRI49019334903066
M01E11.1 Chunk_score Abs_score288
Specificity_index0.272
Rel_score0.373
Overlaps_transcriptF21F3.3 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21F3.31134tgccagaacgacaaaaacaaactgaaaaagggtttgatttagtttgaatttgattcaaagtcagcgatggctcccaacagcactcctccgccaaccttcttcggaagaatcgtgttccatctcacatccgacgatgtcttccgtaccgccatctttgccttcatcgcatcgtttactgtgattgctgcagtggcttctgtgactggaagcttccttgtagggcttctcgcaagtgtgatcgttcttttggtggcttatgcagttggcgaaagttgtgaattcatcaacaatcagattctgatgccggccgcgtttttgggatgtgtaagtttttttcctggttttttaaaagtttttcgctaggcaatttcaatattttaaattttccaggcagtcgcagtgaacttggtctacacggtagctcacgaaggagagctctgggaatatttttctcgatatttcctcttcctctccgtgttccatttctccgaattcgtcttcacagcactgaccaatcgccgaactcttggacccgattcgttccttttgaagcattcttttggatattggcttgctgcatccattggttggattgagtttttgattgaggtaagaataaacttttaagtgtaaacaaactaagacacatgtcttgttagtagaatatcaaaaattcaaataaaacattttaacagttgtgtcgttccaggccaacttctaccccgaaatcaagatgtattcggttctctggattggaacattcggttgtatcattggagagattgtcagaaaagtcggtatggttcatgctggattggcattcactcatcttatggcaaggaccaaaagatcaggccacactcttatcaataccgggatctacgcgtacatgcgccatcctggatattttggttggtgattttggaattttttagaaatataaatacttttatttttcaggttggttcatttgggctgtctcgactcaaattgttctctgtaatccaatttcctttgttatctacacttttgtcacgtggcgtttcttcgccaaccgaatcgaaattgaagagaaggatttgatttcattctttggtgatgattatgccgagtatcaacgcaaaacttggtctg