Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21F3.5   

sjj_F21F3.5RNAiJA:F21F3.5
PCR_productsjj_F21F3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21F3.5 Source_evidenceePCR804WS150 Sequence/Annotation Release
Overlaps_Gene F21F3.5 Source_evidenceePCR804WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699F21F3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI48988214900458
Overlaps_transcriptF21F3.5 Source_evidenceePCR804WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21F3.51638tcctccctttgaagttggtgtgatttcttggacgatttttaaataaagaatgactgtattttttgattaactgacatcatttcgagtttaaaaaaacgactcacaaataacagtaaccacgacagaaagtgtaaccatcaccattgtgaacagtagatattttccaatcagtggcaacgtgatcgatgtggccggaatgatttcagtgagcagcaagaagaagatagtcaaggcgacaagaattgatatacaaagtgtcactttctctccagaatccgatggaagatagaatacaagaattgtgagaaatgagatcccgacacatgggaagaccagattgactgtgtagaagagcggtttacggcggagttggaggtaatactgaaaatacgttttgtgatttgttgcgtttggtttaggagcgtacaatgtacttttcaattctggcaaaatttggctgaagtttcttattcaaactttgcaacttctcgtgtttctatgaatagtaattttctttcaaaattaatggccctaactagaaaattcgaaatctaacgtttgactgtatttaaatattaacttgatttacgatctagaatactgtactcatatctttacgtttgcaatcttttttaaattcaaatttgttcggaaaaataaatattttcattaagaccatacttacagtaacatcaatataagcactctgtggacaacaacttggatagttctttgctcttcttttggcaactcttgacataatatcccattcgacagatggataataatcggataaatcaattccatcttcggcaacagttacattgtctattatccccttttcgtcaatttcttcttcgtatcggagacttggttcgttcaattccacggagagcagattttcagaaaatgtccaggagccgaactgccaaatgttcaaaaattagttgtttgcttttctagagatgtaaaagaatgcctactcgtatatctttccccatatggatgccggaaagatcgacaactaaccgtccaaagcagttaagaaattaaaatttacagcaaatcagcaaattggcggttttctaattgccggaaatagctatctgccctggtttaagagctagtgtattacattttacgcgcacatatttctgaactagacattcaactacaaagcactgggggcggtttttaagaacatcagaaaacattattgctcttttttgtaaaaaaatttcaaaaattatgaaaagtaccttcaaatggcattgttgctcatcaaacgggaaccatcttacatcaatttgacacatactcttgaagattgctggtggctcccaggtaacttctccagtgtaatgaagtgttgcttttgttgaaattgtgatgttgtagttgctgtcagcgctgcaaaattgaacaatttaaatatatatttcgattattttcaggtatttctacagaagagggttttttccagcaatttcccataaacttacttattgtacaggacaatatccggtacccaaatcatttcataaggaacatataatacatttacacccccataattcactggatcccatgagagttttctgtcaatccatgtctgttttaaccaaaccgaacacgtca