Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F21H7.10   

sjj_F21H7.10RNAiJA:F21H7.10
PCR_productsjj_F21H7.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21H7.10 Source_evidenceePCR1041WS150 Sequence/Annotation Release
Overlaps_Gene F21H7.10 Source_evidenceePCR1041WS150 Sequence/Annotation Release
Chunk_score Abs_score878
Max_abs_score878F21H7.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1625709416258747
Overlaps_transcriptF21H7.10 Source_evidenceePCR1041WS150 Sequence/Annotation Release
WB_DNA_textsjj_F21H7.101654atgcttgatgcccctatgagaatcaaacacatgagttggcacatggaatgtgtaccctgcacgacagagggcatacacctggaaaaggtaaaaaaatatataaaaggataaaaaattggctaccaaggagtgcataaccttgatcctggatgggaaatagtcagcgttgtaagggtcgttgcgatgcagaattgtttgcacttcccagagatagccactgaaattttttttaaagaaaaagacgagaaaacattttggcaaattttcagggtccgacatctgccgggttttgcgccgtatgcattgttggggatcggctcaaagtcagggttgcaaaatttcagaatttttcgaacaaaaaactaaaaaaaaacgtaacacgaacgggtaagctacttccttcgtggtgaccacccctgaatgaatcgaagtcctgaaccaatcgtcaagcccatcaatatgatgtccttctgggaaatagcgatggtgaaactcaaaagttctgaaaagcttaaaatttcagctggctcaaacccgaattaacttacttgtgcaactttttcgactttaacaatttcagatgatctcttggaatttctgcagtatcagaagtctcaaaccttcgaatggccaaaactcttttgttcttcccatcaataacttcattagcaattcgtttaattttcgttgcaaatccctcactaggaaccatatctccatccattatgaactgaagatcagtttgggctccttttcgagcaatattccgcattagattgctggggtataactggaaagggccaacaattgcgttgcggagttctgtgtctaaaagaaaaatttaaaaagataggaaatttcagtgaaaaaaattatcttacgagtagcaaagaattcctggcatgatctgtttgactgcggaatttcaatcagggggcattcggtttgaaatggagatcggcggaatgcaaagtgtacattcatctgtaaaaatacagaaaacaatttgaagataactgtgaccaatcagcgacgttgaccacgccctttgctcagcgagcgctgattggtagcacaagaaaaacggctctgtttccttacctttcttctgaaagaaacgtcacatcgatgcacttctgctaggtactcaagaacattataagaatgataatcaacgaatattccaattgaaatcggcccatcccacagaaaagtcatattttcaacagtctcaatcatatctgcagttgcatgagttgccagagttactggttctaggccgtctgcctcgcgaaatctaaaattttcaataaatgctgtgaaaatctgattagtgattagatactcacgattcagttgcttctaaaaatttgtacgcgatacaatattggtcagcatgcatttcggtttgaatagagtaacttcggcgttcgccttcttcggcaggattttctattgtgtagtacttattggggtaaccattttccaggagagcatcagatgaagtatagcttttcctatgctgaaaaatatttttttaagactactgacgggaaactattttcagtcagttttctcaattgctagggaaaatttaacgaactcttcaattttttttaaaaatttattatgttctcccgcatgaaacaaatct