Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22B3.4   

sjj_F22B3.4 RNAi JA:F22B3.4
PF:GL1_1A12
PCR_productsjj_F22B3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B3.4 Source_evidenceePCR798WS150 Sequence/Annotation Release
Overlaps_Gene F22B3.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764F22B3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1141191811412845
Overlaps_transcriptF22B3.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22B3.4928ttgttcatctcgcagagtggagagacggctgatactctgatggctttgagatactgcaaacctcgtggagctctcacaattggagttaccaacacagtcggatcgtcgattggtcgcgaatcccactgtggaattcatatcaacgctggtccggaaataggagttgcttcaaccaaggcctacacctcgcagattgtatcacttctgttgttcgcactcaccatctcggaagatcgcatctcgaagatgaagagacgtgcagagattattgatgctctcaataatcttccaattctgatccgcgatgttctcgatctggacgatcaggtactgaagatcgctgagcaaatctacaaagataagtcacttctcattatgggacgaggattgaactttgccacgtgtctcgaaggagctctcaagatcaaagagctctcgtacatgcattgtgaaggaatcatgtctggtgaactgaagcatgggcctcttgcaatggtcgatgaattcctcagcatctgcatggtagtatgcaacgatcatgtctacaaggttacaattttatcaactgagttattttaaacaaatttatattttcagaagtcgttgaatgctcttcagcaagttgttgcgcgaaagggagccccgatcattattgccgatagcagcgttccggaaagtgatctcgctggaatgaagcatgttctccgtgtcccaagaacagtcgactgtgttcaaaacatcctcacggtcattcctctgcagcttctctcctaccacattgctgagctcaatggagcaaacgtaagttttcacattctatcaaaaagcaaatgtaatattcgtttttttttcaggtggaccgaccacgcaatttggcaaaatctgtcactgttgagtaagccaatccgtcaaccacatccttgctcaa