Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22B5.8   

sjj_F22B5.8 RNAi JA:F22B5.8
Simmer:F22B5.8
PCR_productsjj_F22B5.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B5.7 Source_evidenceePCR1006WS150 Sequence/Annotation Release
Overlaps_Gene F22B5.7 Source_evidenceePCR1006WS150 Sequence/Annotation Release
Chunk_score Abs_score964
Max_abs_score964F22B5.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII84630338464114
Overlaps_transcriptF22B5.7 Source_evidenceePCR1006WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22B5.81082ttgatgggaggagtcgaaactgagcacggccttgagccacttaatgcgtcccccgacacagtcaaagccatcatctcttcggtcctcagatgtatcatccaaatcggtaacacagagtccggatacggaatggcaagatctctcaatcgactggcaatgcgattaatctacagagttgagctgtctaatctgttgtgcggattgattctggcaatgactgaatcacttcaaatgaacaccggtataaccgaacttgtgtcgaagctctcgtcgaaatggtgtgatgaacttgaaaagagaagagctcaactgagagcctcggatatagtcgactcattcaatgctttctacgtttgtgcactcacagaacttaaaatggacatcagcgattcacacattttgatagttgataactatttggagcgggttatccttcagcaaggagacgtcgtcttggatgctgcccgtcgtctttctcgaccacatatgcacttgaccagtatgatcaacaagattttacaaatgatgagagaacgaaaaattgatcctatcatgcctggaacattggaagccagaatgccacaagaggatgaagcagttgtagtgcgaagcggcgttcaagtttcgatcgacaatattctgcgtgatacctcgatggcagttaaacatattgagcaactgaatattctcattgcatccagtgaccgatcttggaatgagtatatggaatatctcaaaaataatccaatgggagagctcatcaaggagctagtcggcgagtgttccagaaagaagaggattgactttaacctctctcatgtcgttaaatcgtcaatggcagttttcaaagccatggcagctactggtcctgttcaagaggaaggtagaataactccaacagatataaacagaatggatactatgattgtgtaagtttcataagacaaagaacgtaatttagctctcatctcatattttgccaaactaaaaaaaactaattttcagtggaacacctctatctcgtggagacgcaaccatcactcgtgcgcgtggaaacatgatccgtccaaagagaaccacat