Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22B7.5   

sjj_F22B7.5RNAiPF:GL1_8B9
PCR_productsjj_F22B7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F22B7.13 Source_evidenceePCR1059WS150 Sequence/Annotation Release
C38C10.4 Source_evidenceePCR1059WS150 Sequence/Annotation Release
Overlaps_Gene F22B7.13 Source_evidenceePCR1059WS150 Sequence/Annotation Release
Chunk_score Abs_score692
Specificity_index0.41
Rel_score0.695
Map_statusBest_ePCRIII86289478630106
C38C10.4 Source_evidenceePCR1059WS150 Sequence/Annotation Release
Chunk_score Abs_score996
Max_abs_score996C38C10.4
Specificity_index0.59
Rel_score1
Map_statusBest_ePCRIII93917899392950
Overlaps_transcript F22B7.13 Source_evidenceePCR1059WS150 Sequence/Annotation Release
C38C10.4 Source_evidenceePCR1059WS150 Sequence/Annotation Release
WB_DNA_text sjj_F22B7.5_11160tacgaggatggaaaaggacgcttagaggagataatggagttcggaacctcaaattttcaactacttggtacaatctacatgtattacggaagagtgtgcaggcatttgaaccatgatgccaaggccttggagtttttcgaacatgagttgaacatgttcaagtaagtgaatcacaaaaatgagctggacattctataaccttaatttttcagattgatcttcaactacccagaagcatgtgattccacacgtcgcatcgtcgagcaggcactcaaaatgggaaagttccccaaggctcgacggtttgctgaggatctcattgattacaccagcaataagaagaacggagagaagtatatcggtcaagctcgaattttgttcgcttccgtgtgcctcgaaggatgtgaaagagacgtcgagagtaatcaagatgagaagaagaagcttttgtcaatatgtgctgaacagattgcagccgtgaaattgttcaacgagaataatacggaaggagctgtgtctgagaccaaaatcatgttacttgaggcgaaatgcttgtcactagacgaaaaatacgaggaatcgcgtcgcaagtatcaagaatgcatcgattttgccatcaaaacagaccagtttgaagcagttcacatcgcctattacgacaaggctctatatgctgagacagatcttcttttctttattatcagagatctcaggtaatttttagttttaacgattaataaaaatatcaattctttattcacagaagtgctctcttctacgccacgaaattcggaaaagagcgagatgtagtcaaatataagtcgaagctatccgaagagatgctgagaaatggcgaattccacgaagcatatctctacggattggaagcgcttgtatcgattcggaagcttggattgaacgaatacattggagatgtgttgcttacaatcgcaaagtgcctcattgcacttggaaaaagacgccaagctgcttattttatcatcttggggagtgttctgaccatcaaccaaaacagtttcaaactgttctacgagcagatcgacgtggcgatgaatcaagagagaagcgaaacggcaactgatcaagatgtatgcctcgcaattgattcgtctcctgatccgacatcctcgaatgacatg
sjj_F22B7.5_21162catgtcattcgaggatgtcggatcaggagacgaatcaattgcgaggcatgcatcttgatcagttgccgtttcgcttctctcttgattcatcgccacgtcgatctgctcgtagaacagtttgaaactgctttggttgatggtcagaacactccccaagatgataaaataagcagcttggcgtctttttccaagtgcaatgagacactttgcgattgtaagcaacacatctccaatgtgttcgttcaatccaagcttccgaatcgatacaagcgcttccaatccgtagagatatgcttcgtggaattcgccatttctcagcatctcttcggatagcttcgacttatatttgactacatctcgctcttttccgaatttcgtggcgtagaagagagcacttctgtaaaaatagaattgacatttttattaatcgttaaaactaaaaattacctgagatctctgataataaagaaaagaagatatgtctcagcatagagagccttgtcgtaataggcgatgtgaactgcttcaaactggtctgttttgatggcaaaatcgatgcattcttgatacttgcgacgcgattcctcgtatttttcgtcgagtgacaagcatttcgcctcaattagcataattttggtctcagacacagctccttccgtattattctcgttgaacaatttcacggctgcaatctgttcagcacatattgacaaaagcttcttcttctcatcttgattactctcgacgtctctttcacatccttcgaggcacacggaagcgaacaaaattcgagcttgaccgatatacttctctccgttcttcttattgctggtgtaatcaatgagatcctcagcaaaccgtcgagccttggagaacttttccattttgagtgcctgctggacgatgcgacgtgtggaatcacatgcttctgggtagttgaagatcaatctgaaaaattaaagttatagaatgcccagcccatttccgtttaattcacttacttgaacatgttcaactcatgttcgaaaaactccaaggccttggcgtcgtggttcaaatgcctgcacactcttccgtaatacatgtagattgtaccaagcagttgaaaattggaggttccgaactccattgtgtcctctaagcgtccttttccatcctcgta