Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22B8.4   

sjj_F22B8.4RNAiJA:F22B8.4
PCR_productsjj_F22B8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B8.4 Source_evidenceePCR850WS150 Sequence/Annotation Release
Overlaps_Gene F22B8.4 (3)
C06B8.2 Chunk_score (3)
Overlaps_transcriptF22B8.4 Source_evidenceePCR850WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22B8.41169cgttggatcacaagagcagattatggtggatctgacgattcctgttaaaaatgattcagatattatgtttttatctgccacatcaaaaaaccacctgtttaatttcaatgaaatggtaaaagttcatcattttattttgagacttttttcataatttctcgaattaattcagtagaacaaatcttaatgcttttcttttcagtataacattgtacatcgcaattggccaaatcaaaacataattctttattctttggatcttaccgacactcaaatacttgacatcgaaaagagacctaatgtcaaagtacggaaattcgattattccaagtatccgaaatatgtagaaaactggatggaatatcgtttcaaagcactgattttggcagtgagttttggtttgaaaatggtaacagagttagttttgaggaagcgattcgagattatgcaaatgtttggtggattgatgcccatacaaaatgggttcatccgaattcattggatgccgtttatggagatctggcagaatgcgccaacgatgttaactgtacgaaggtttgtagaaaagcataggtgcgtatttatcaatataattttttagaactcctcaattcaaacatttatcaattcaacgcacagcaattatgcagttcttacaaaaggtgtgtttttttgattcgaaattttagaaacttagaagtttcaggacttcttgactattttcccacgtttgacacagatgttctgaaaacaaacgaaaaaggccttcaagtatctgcaatgctggtgtatttggctcgaactccattcactttggagatcttgaaatggtagggttatttctcatgcatgtgtttaaaaaattgcttaactcaaaaacattaccttctgaaacaattccaggcatgccctttgcgcactagaagaaaagtgtatgaaccccccgacagcaaaactgaagtgcgacatcattcccacctggaattcttatgcaggatgcttccggtacgatcagtcatcaatcaatattttgctgttcaatcagtttcgagatcacaacagttactttatggcaaagaatgttggtgtagttaatcggacgtattaggaaattagaaatttagatagccgggggttttcctattcgttttgcacccttgctctacctt