Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.1   

sjj_F22D6.1 RNAi JA:F22D6.1
Simmer:F22D6.1:Repeat_b
Simmer:F22D6.1:Screen_A
Simmer:F22D6.1:Screen_B
PCR_productsjj_F22D6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22D6.1 Source_evidenceePCR781WS150 Sequence/Annotation Release
Overlaps_Gene F22D6.1 Source_evidenceePCR781WS150 Sequence/Annotation Release
Chunk_score Abs_score655
Max_abs_score655F22D6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70759777078195
Overlaps_transcriptF22D6.1 Source_evidenceePCR781WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.12219acattggcattgagaggtctttaagcttatgatgcacagtcttcatcgtggcacgatccgatggaagtttcgcccagcattgtttcaaagcgatttcagaaatggttggtggggtagtctggaagttacaatatgatttttgtcttcatcgctgaagcatttaaaaattacctcaggaaaagtcattctgtaatcatcgcagaagatcttggctctcgtaactaagtttgtcattcccggatatggatcagctccatctgcatatatctcccacatgagcactcctgaaacatagtttctattaacttacgagctagcaaggttacattaattctattcaaaaattgaaatgatagaagatttcgattgaattaactggtttaactattttgagagttttttaaaaaagtttttcagttgttgtagatttgaaactaccactatgtgagctttccaaatcatccaattgggtataattaataaagtatggaattaggataaatgtgcctccaggccaccactggggaatccttcttgtctctttacacgccctaccgtatgcttcgagtatttgtcacacatttttgcccgccgtgcttgtcctggtagcagtgggtcgacccacttctacttctatactcaaggagcatttcatgctatatcataatgctacaaacattaaaaaaaacaactcaccaaatgcccaaacatcacttttcaatgaatacaatttatcctgcataacttccggagccaaccatttcactggtaccttatcgagtgtgtcatcatgcatttcagttcgtttgtcatccgaaagaccaaaatccgaaattttaatttgctgaaagcatcgttcatgaggcaaaacgctcagctctatagaaaactaacatcggtgatcgaaagtaaacaatttctggctgcaatatcacgatgaagacattgttttttctcaagatatgcaagaccatcggctgattcaatacaaaaacgaagacgttcggaaagtgtcgttttccctttgttcttacgaagaaatgaaagaagtgatccatctgaaattgggaaacacattaattaaaaatattctggttagaggtcgttataaaacttacgtgggcacatctccattacaatcattagtggatgagcatctactgccaaacctacaagtagagatcttgtatgaataatttcaacataaatcataaccaagtatcataacttcaagaatttttatagccttaaaattttcagttaaagtttcgttaaattgacaaacttttgtagattgttttcgttgttttcgttactgaaaatgtaagcttctcaaaggcagttttcaaaaatgtcccctccatattgctttcaaagtcttttcacatgatcaaatccaattcataaattcatttatcttcctgtccactcacgcacaacttattctaaacaatgataaataaacaaaaacaaattagaaaataagctcatgaactcgtcatgtaatctgaactattctattacgcctcttattccagaggtatagaatttcccgtcgttattttagcaagtgtatggagttatatgattatgaaaaattagaatattgtacttctaacagtgtttgtaatctctccaaatataaaaggaaaagcgccattttttcaatttttcaaatgcttttcaatctcagcatttgggtccagcctcttgcccaagtctggcccacaactattaatttaaattgctagggcaaaagttgatcttacaataagataaaaaatttggaaaatttgagtgggacgctggagccaaatgccgaggtttgaaacttctaaactacgtttttctccgtaatttcctaaaagctttgagtttactttactcgaaaagatatcaaaaaatattctgtgaggcatgtctctcaacaagttagtgtaagattataagtaggttcaggactggaaatacggtatatattacaaaaactgagtactgtagtttcaaacttaccaacttttggaagatgtttgacgattatcttaccaataatccgaacaatatgtggatgtgaatactttctcataagccttgcttctttcataaaagcagcacgagtatctcttgtcatttggcatctcatcgtcttcaccgcagtttccacttttcttcctccaatctcacattcagcaagtgaaaccttgaagaaaatcatgcaa