Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.13   

sjj_F22D6.13RNAiJA:F22D6.13
PCR_productsjj_F22D6.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F22D6.6 Source_evidenceePCR254WS150 Sequence/Annotation Release
Chunk_score Abs_score212
Max_abs_score212F22D6.6
Specificity_index0.606
Rel_score1
Map_statusUnique_ePCRI70980887098553
F22D6.7 Chunk_score Abs_score76
Specificity_index0.217
Rel_score0.358
F22D6.9 Chunk_score Abs_score62
Specificity_index0.177
Rel_score0.292
Overlaps_transcriptF22D6.6 Source_evidenceePCR254WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.13466tcgatttctgttccagtcaaaatccaaatgttaattctcttccaatctattttatattgttttttcttatttaagtttttcaataatgggatgatgcaagtgaatttctcgacatttctcgacaatttttttgcaatgcaagtgtgcggagaaatgacgagaattgacgtgaaattcgcaatttctccgcatttctcgacatccacacataccgtagttggggacgttgttggcggcaaatcgcggcgagacccgctgtgtcgatttacgaggatatagctaatgttagtttttcgcaataaactttgtttttctgtcgttcttgttcaattttcgtgatcttttcgcagtttttactctttttttatgtatatttattgaatttaatatcgtacttcctaattccatgcgcaatcgaacgtcatttatagttttaaagctattttcggtggcttaaagaaataca