Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F22D6.2   

sjj_F22D6.2RNAiJA:F22D6.2
PCR_productsjj_F22D6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F22D6.2 Source_evidenceePCR661WS150 Sequence/Annotation Release
Chunk_score Abs_score577
Max_abs_score577F22D6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70803467081719
Overlaps_transcript F22D6.2.2 Source_evidenceePCR590WS150 Sequence/Annotation Release
F22D6.2.1 Source_evidenceePCR661WS150 Sequence/Annotation Release
WB_DNA_textsjj_F22D6.21374gaaaggagcgttacaaattgatgacgatcatgctcgcgcacaacaccgagaagaagcagcaaagggttttcaaattctttgaactttatccgacacgacgacaggattattttttctgatggtttcacgttccatcgtcttgtaatcgaactgacagttgtgcgcttggtcgtatcgatgatcaccacagtacaatcctccacatctacacgagaaacctgaaaaaacacaattatcattggctgaattccgcttttaaaaaattctaagaatttgaattgcagtaacactaaccagtaagtccaacccgttttttacacatatggcatctatttgcttttttcaccgggacaggaacgtctacagtaattgtcgttggcgcagtgctttccgcaaccctggaaaatgtttcattcgagataatcgatgttaagaatcaactcacgtcaccgaatcatcattaatttggtcacaaacgttgataatatcttcgcagtccatcttcgccgtttcatcggacacgctgacagctgctttcatgcacatatccacacttgaaggctcagatttaagggctgaagatgtggcggccatcgatgaaggagaaacaactgaaaaatgaaatcagtgagtacaccccagtgccgtcacatattacatcaaccagtcatgaggccagccgataacatgattggtcagcgatcagttgatttagtcatttcgaaactaagcggaacattataaatttcaattctttttttcaaaacgaattcaaaaatgatttcctctaggctcaacgcattaataatacatactttcatggattagtcatatctctttcgcgccaatatatgcaaaatattttatgaaagtgagtgtgacatctactatctagcattaaacttttcctctggtctttttgaaaggaactaagaagttgccatatattgatttcataatagaagccttcaattaaaaatacgaattgtttaaaactactcaccaggagaagtcagcctcacagtgtcttgctggcgtttcagggtgttcttgaagcactgggaacagtaaccttccgttgccgatgcgccgaaaaatccacatccagcacggcaggagggagcggtctgagcttgttgttgttcgttctccattggtggacctgagcgacgccctgcagaaaattgagaatattattaaatcatttcaaaattgaagataagaaagaaaatcgatgcgaaacaaagtacatatgtgatatcggcgagaaaacagtcgctgtaacaaagaaacgaaacgacagcagcggagacataaaagacgtcaccatgtgatctcttcagaaaggctatatttcgaacacgtaggcacttt